Table 2 |
|||
|
Sequences and genomic positions of mapped HERV-W gag (A) and env (B) elements. Dashes indicate nucleotides that are identical with the prototypical HERV-W sequences. Open circles indicate gaps in sequence. Sequences that could not be unambiguously mapped to one genomic loci are indicated by the number of indistinguishable genomic loci found. |
|||
|
A |
|||
|
|
|||
|
5' LTR |
5' HERV-W gag 3' |
Tm(°C) |
Genomic location (strand) |
|
|
|||
|
Truncated |
GAGGAAooAGAACAACTCCCooACAGGCCAGCAGGC |
80.2 ± 0.2 |
3q26:180256375-180256406(+) |
|
None |
--A---AG-------T----C--------------- |
80.2 ± 0.2 |
5p13:31432195-31432224(-) |
|
Truncated |
---------------T----C--o------------ |
80.9 ± 0.2 |
12p13:8809216-8809247(-) |
|
None |
------AG-------T----C------------A-- |
79.7 ± 0.2 |
12p12:18113623-18113657(+) |
|
Complete |
------AG-------T----CC-------------- |
80.2 ± 0.2 |
1q42:224124801-224124836(-) |
|
n/a |
--------------------C--------------- |
80.2 ± 0.2 |
2 elements |
|
n/a |
------AG-------T----C--------------- |
80.2 ± 0.2 |
15 elements |
|
n/a |
------AG-----G-T----C--------------- |
80.2 ± 0.2 |
11 elements |
|
n/a |
---------------T----C--------------- |
79.7 ± 0.2 |
4 elements |
|
|
|||
|
B |
|||
|
|
|||
|
5' LTR |
5' HERV-W env 3' |
Tm(°C) |
Genomic location (strand) |
|
|
|||
|
n/a |
TCCTCCCACACAAATAGTCTGCCTACCCTC |
77.6 ± 0.2 |
5 elements |
|
Truncated |
---C---o---G------------------ |
78.1 ± 0.2 |
15q21:53385581-53385607(-) |
|
None |
A----------G------------------ |
78.7 ± 0.2 |
Xq22:106102713-106102742(-) |
|
n/a |
-----------G------------------ |
77.6 ± 0.2 |
5 elements |
|
|
|||
|
Nellåker et al. Retrovirology 2006 3:44 doi:10.1186/1742-4690-3-44 |
|||