Table 1

Primer sets for RT PCR

Target

Primer Sets


forward

reverse


α-tubulin1)

cacccgtcttcagggcttcttggttt

catttcaccatctggttggctggctc

GAPDH2)

gaaggtgaaggtcggagtc

gaagatggtgatgggatttc

β-actin3)

atggatgatgatatcgccgcg

ctagaagcatttgcggtggacg

7SL3)

gggctgtagtgcgctatgc

cccgggaggtcaccatatt

Vif

gatggcaggtgatgattgtgtgg

ctgtccattcattgtatggc

hY14)

ggctggtccgaaggtagtga

aaagactagtcaagtgcagtagtgag

hY34)

ggctggtccgagtgcagtg

aaaggctagtcaagtgaagcagtgg

hY44)

ggctggtccgagtgcagtg

aaagccagtcaaatttagcagtggg

hY54)

agttggtccgagtgttgtggg

aaaacatgcaagctagtcaagcgcg

U15)

cctggcaggggagataccatgatcacg

ggggaaagcgcgaacgcagtccccc

U25)

cttcttggccttttagctaagatc

ggtgcactgttcctggaggtactgc

U45)

gctttgcgcagtggcagtatcg

cagtctccgtagagactgtcaaaaattg

U65)

gtgctcgcttcggcagcacatatac

ggaacgcttcacgaatttgcg


1) Eppendorf cMaster RTplusPCR system (Eppendorf Inc. Westbury, NY)

2) Funaki et al. 2003 [54]

3) Onafuwa-Nuga et al. 2006 [28]

4) Chiu et al 2006 [22]

5) Giles et al. 2004 [41]

Khan et al. Retrovirology 2007 4:48   doi:10.1186/1742-4690-4-48

Open Data