Table 1

Primer sequences used in XMRV-specific PCRs

Primer

Sequence

Reference


419F gag

ATCAGTTAACCTACCCGAGTCGGAC

Lombardi et al, 2009

1154R gag

GCCGCCTCTTCTTCATTGTTCT

Lombardi et al, 2009

5922F env

GCTAATGCTACCTCCCTCCTGG

Lombardi et al, 2009

6273R env

GGAGCCCACTGAGGAATCAAAACAGG

Lombardi et al, 2009

hGAPDH-66F

GAAGGTGAAGGTCGGAGTC

Lombardi et al, 2009

hGAPDH-291R

GAAGATGGTGATGGGATTTC

Lombardi et al, 2009


Real-time PCR

6173 env F

GGCATACTGGAAGCCATCATCATC

6173 env R

CCTGACCCTTAGGAGTGTTTCC

6173 env probe

ATGGGACCTAATTTCC

6682 env F

GTGCTGGCTGTGTCTAGTATCG

6682 env R

GCAGAGGTATGGTTGGAGTAAGTAC

6682 env probe

ACGGCCACCCCTTCGT


Groom et al. Retrovirology 2010 7:10   doi:10.1186/1742-4690-7-10

Open Data