<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1742-4690-4-48</ui>
   <ji>1742-4690</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Analysis of the contribution of cellular and viral RNA to the packaging of APOBEC3G into HIV-1 virions</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Khan</snm>
               <mi>A</mi>
               <fnm>Mohammad</fnm>
               <insr iid="I1"/>
               <email>mkhan@niaid.nih.gov</email>
            </au>
            <au id="A2">
               <snm>Goila-Gaur</snm>
               <fnm>Ritu</fnm>
               <insr iid="I1"/>
               <email>rgaur@niaid.nih.gov</email>
            </au>
            <au id="A3">
               <snm>Opi</snm>
               <fnm>Sandrine</fnm>
               <insr iid="I1"/>
               <email>opi@marseille.inserm.fr</email>
            </au>
            <au id="A4">
               <snm>Miyagi</snm>
               <fnm>Eri</fnm>
               <insr iid="I1"/>
               <email>emiyagi@niaid.nih.gov</email>
            </au>
            <au id="A5">
               <snm>Takeuchi</snm>
               <fnm>Hiroaki</fnm>
               <insr iid="I1"/>
               <email>htake@ims.u-tokyo.ac.jp</email>
            </au>
            <au id="A6">
               <snm>Kao</snm>
               <fnm>Sandra</fnm>
               <insr iid="I1"/>
               <email>skao@niaid.nih.gov</email>
            </au>
            <au id="A7" ca="yes">
               <snm>Strebel</snm>
               <fnm>Klaus</fnm>
               <insr iid="I1"/>
               <email>kstrebel@niaid.nih.gov</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Laboratory of Molecular Microbiology, Viral Biochemistry Section, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Building 4, Room 310, 4 Center Drive, MSC 0460, Bethesda, MD 20892-0460, USA</p>
            </ins>
         </insg>
         <source>Retrovirology</source>
         <issn>1742-4690</issn>
         <pubdate>2007</pubdate>
         <volume>4</volume>
         <issue>1</issue>
         <fpage>48</fpage>
         <url>http://www.retrovirology.com/content/4/1/48</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17631688</pubid>
               <pubid idtype="doi">10.1186/1742-4690-4-48</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>04</day>
               <month>5</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>16</day>
               <month>7</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>16</day>
               <month>7</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Khan et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Efficient incorporation of the cellular cytidine deaminase APOBEC3G (APO3G) into HIV-1 virions is necessary for its antiviral activity. Even though cellular RNAs are known to be non-specifically incorporated into virus particles, we have previously found that encapsidation of APO3G into HIV-1 virions is specifically enhanced by viral genomic RNA. Intracellularly, APO3G was found to form large RNA-protein complexes involving a variety of cellular RNAs. The goal of this study was to investigate the possible contribution of host RNAs recently identified in intracellular APO3G ribonucleoprotein complexes to APO3G's encapsidation into HIV-1 virions.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Our results show that 7SL RNA, a component of signal recognition particles, and hY1, hY3, hY4, hY5 RNAs were present in intracellular APO3G complexes and were packaged into HIV-1 particles lacking viral genomic RNA unlike APO3G, which was not packaged in significant amounts into genomic RNA-deficient particles. These results indicate that packaging of 7SL or hY RNAs is not sufficient for the packaging of APO3G into HIV-1 virions. We also tested the encapsidation of several other cellular RNAs including &#946;-actin, GAPDH, &#945;-tubulin, and small nuclear RNAs and determined their effect on the packaging of APO3G into nascent virions. Again, we were unable to observe any correlation between APO3G encapsidation and the packaging of any of these cellular RNAs.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The results from this study support our previous conclusion that viral genomic RNA is a critical determinant for APO3G incorporation into HIV-1 virions. While most cellular RNAs tested in this study were packaged into viruses or virus-like particles we failed to identify a correlation between APO3G encapsidation and the packaging of these cellular RNAs.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>APOBEC3G (APO3G) is a member of the family of cytidine deaminases that in humans include APOBEC1, APOBEC2, seven APOBEC3 variants designated APOBEC3A through 3H, as well as activation-induced deaminase (AID) <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. The protein has potent antiretroviral properties and is expressed in all major target cells susceptible to HIV-1. A crucial prerequisite for antiretroviral activity is the packaging of APO3G into assembling virions. APO3G is efficiently packaged into <it>vif</it>-deficient HIV-1 particles but is largely absent from wild type virions <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. A number of studies have shown that packaging of APO3G into virus-like particles (VLP) is mediated through an interaction with the viral Gag precursor <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. <it>In vitro </it>studies demonstrated that the APO3G-Gag interaction is sensitive to RNase-treatment suggesting a possible role of RNA in APO3G encapsidation <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr><abbr bid="B14">14</abbr><abbr bid="B17">17</abbr></abbrgrp>. Consistent with these studies, we previously observed that efficient packaging of APO3G into <it>vif</it>-deficient HIV-1 particles required the presence of viral genomic RNA <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Furthermore, even though small amounts of APO3G were packaged into particles in the absence of viral genomic RNA, such APO3G was sensitive to detergent treatment of the virus and therefore not stably associated with the viral nucleoprotein complex <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. HIV-1 virions containing genomic RNA packaged approximately 3 times more APO3G and the APO3G found in such virions was largely detergent resistant, indicative of stable association with the viral nucleoprotein complex <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Other studies support the significance of viral genomic RNA for the encapsidation of APO3G into HIV-1 particles <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>.</p>
         <p>APO3G is an RNA binding protein <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> and recent studies demonstrated that intracellular APO3G can assemble into high molecular mass (HMM) RNA-protein complexes <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. Intracellular HMM complexes of APO3G are thought to lack cytidine-deaminase activity and are unable to restrict retrovirus replication <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B22">22</abbr></abbrgrp>. Recent analysis of APO3G complexes identified a variety of cellular RNAs including Alu and hY retroelements as well as mRNAs encoding APO3G, ubiquitin, and protein phosphatase 2A <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B23">23</abbr></abbrgrp>. On the other hand, messenger RNA encoding &#945;-tubulin was not identified in APO3G complexes <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Similarly, &#946;-actin mRNA was found to be absent from <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> or underrepresented in APO3G complexes <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>.</p>
         <p>Retroviruses including HIV-1 package small cellular RNAs in addition to two copies of viral genomic RNA <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>. It is not clear how cellular RNAs are packaged into virions; however, most cellular RNAs appear to be packaged randomly and independent of genomic RNA <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B32">32</abbr></abbrgrp>. Furthermore, the efficiency of encapsidation of most of the cellular RNAs seems to reflect their cellular abundance <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>. One of the first cellular RNAs identified in murine and avian retroviruses is 7SL RNA <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>. 7SL RNA is a critical component of the signal recognition particle and is involved in the recognition of the signal peptide during protein translocation across the endoplasmic reticulum <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. More recently, 7SL RNA was also identified in HIV-1 virions <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B32">32</abbr></abbrgrp>; however, so far no functional significance has been associated with the presence of 7SL RNA in retroviral particles.</p>
         <p>The current study aimed at the investigation of the possible involvement of cellular RNAs in the encapsidation of APO3G into HIV-1 virions. We focused on RNAs previously identified in intracellular APO3G complexes (e.g. human Y RNAs <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> or HIV-1 RNA <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>) or previously found in retroviral particles (7SL <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B32">32</abbr></abbrgrp>; snRNAs (U1-U6) <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>). We also analyzed mRNAs previously reported to be excluded from intracellular APO3G complexes (&#945;-tubulin and &#946;-actin <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B23">23</abbr></abbrgrp>) and we randomly chose glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to study APO3G binding and virus encapsidation of its mRNA. Our results confirmed the presence of hY1 and hY3 RNAs in intracellular APO3G complexes. In addition, we identified 7SL RNA, U6 snRNA, and GAPDH mRNA as novel components of intracellular APO3G complexes. Only small amounts of &#945;-tubulin mRNA were recovered from APO3G immune complexes as reported before <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>; On the other hand, &#946;-actin mRNA was clearly associated with APO3G complexes in our analysis thus contrasting earlier reports. Most of these RNAs were also packaged into HIV-1 virions. Interestingly, packaging of hY RNAs appeared to be inhibited by the presence of genomic RNA while packaging of other cellular RNAs including 7SL RNA was largely independent of viral genomic RNA. Taken together, our data strongly support a role of viral genomic RNA in the specific encapsidation of APO3G. Our results also demonstrate that cellular RNAs are not sufficient for the encapsidation of APO3G into HIV-1 particles and for the functional association with viral nucleoprotein complexes.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Association of APO3G with cellular RNAs</p>
            </st>
            <p>Cellular APO3G is present in HMM ribonucleoprotein complexes. Analysis of the RNAs in these complexes revealed the presence of Alu RNAs and small Y RNAs, two of the most prominent non-autonomous mobile genetic elements in human cells <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B42">42</abbr></abbrgrp>. We wanted to confirm and extend these observations by further investigating the association of APO3G with other small cellular RNAs such as 7SL RNA, Y RNAs, and U RNAs. Messenger RNAs encoding &#946;-actin, GAPDH, or &#945;-tubulin were included as additional controls for the specificity of APO3G-RNA interactions. HeLa cells were transfected with pcDNA-Apo3G-MycHis DNA. Cells were harvested 24 h after transfection, washed with PBS and divided into two fractions: 30% of the transfected cells were used to isolate total cellular RNA as described in Methods; the remaining 70% of the cells were lysed in Triton X-100 lysis buffer. A sample of the lysate (10%) was used as total protein control for the subsequent immunoblot analysis (Fig. <figr fid="F1">1A</figr>, Total). Equal fractions of the remaining lysate (45% of total lysate each) were either immunoprecipitated with a myc-specific polyclonal antibody (Fig. <figr fid="F1">1A/B</figr>, &#945;-myc) or were exposed to Protein-A beads without antibody (Fig. <figr fid="F1">1A/B</figr>, mock). Half of the immunoprecipitated samples were used for immunoblotting to identify APO3G protein (Fig. <figr fid="F1">1A</figr>). Immunoblot analysis revealed the presence of APO3G in the cell extract (Fig. <figr fid="F1">1A</figr>, Total) and the APO3G immune complex (Fig. <figr fid="F1">1A</figr>, &#945;-myc). As expected, APO3G was absent in the mock immunoprecipitated sample (Fig. <figr fid="F1">1A</figr>, mock). The second half of the precipitated samples was used for RNA extraction. RT-PCR was performed on total RNA and RNA from the immune complexes as described in Methods using a series of primer sets as listed in table <tblr tid="T1">1</tblr>. All RT-PCR reactions were done simultaneously. RT-PCR of total RNA identified all RNAs in the total cellular extract (Fig. <figr fid="F1">1B</figr>, Total). None of the RNAs was amplified from the mock precipitated sample demonstrating the lack of non-specific binding of these RNAs to Protein A beads (Fig. <figr fid="F1">1B</figr>, mock). In contrast, several of the RNAs, including 7SL, &#946;-actin, and GAPDH, as well as hY3 and U6 RNA were recovered from APO3G immune complexes (Fig. <figr fid="F1">1B</figr>, &#945;-myc). Alpha-tubulin mRNA, as well as hY1, hY4, and U4 RNAs were amplified only inefficiently from the APO3G immune complexes suggesting weak interaction of these RNAs with APO3G (Fig. <figr fid="F1">1B</figr>, &#945;-myc). In contrast, hY5 cytoplasmic RNAs and U1 and U2 small nuclear RNAs did not appear to associate with APO3G immune complexes (Fig. <figr fid="F1">1B</figr>, &#945;-myc).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primer sets for RT PCR</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Target</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>Primer Sets</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>forward</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>reverse</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>&#945;-tubulin<sup>1)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>cacccgtcttcagggcttcttggttt</p>
                     </c>
                     <c ca="left">
                        <p>catttcaccatctggttggctggctc</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>GAPDH<sup>2)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gaaggtgaaggtcggagtc</p>
                     </c>
                     <c ca="left">
                        <p>gaagatggtgatgggatttc</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>&#946;-actin<sup>3)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>atggatgatgatatcgccgcg</p>
                     </c>
                     <c ca="left">
                        <p>ctagaagcatttgcggtggacg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>7SL<sup>3)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gggctgtagtgcgctatgc</p>
                     </c>
                     <c ca="left">
                        <p>cccgggaggtcaccatatt</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Vif</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gatggcaggtgatgattgtgtgg</p>
                     </c>
                     <c ca="left">
                        <p>ctgtccattcattgtatggc</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>hY1<sup>4)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ggctggtccgaaggtagtga</p>
                     </c>
                     <c ca="left">
                        <p>aaagactagtcaagtgcagtagtgag</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>hY3<sup>4)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ggctggtccgagtgcagtg</p>
                     </c>
                     <c ca="left">
                        <p>aaaggctagtcaagtgaagcagtgg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>hY4<sup>4)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ggctggtccgagtgcagtg</p>
                     </c>
                     <c ca="left">
                        <p>aaagccagtcaaatttagcagtggg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>hY5<sup>4)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>agttggtccgagtgttgtggg</p>
                     </c>
                     <c ca="left">
                        <p>aaaacatgcaagctagtcaagcgcg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>U1<sup>5)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>cctggcaggggagataccatgatcacg</p>
                     </c>
                     <c ca="left">
                        <p>ggggaaagcgcgaacgcagtccccc</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>U2<sup>5)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>cttcttggccttttagctaagatc</p>
                     </c>
                     <c ca="left">
                        <p>ggtgcactgttcctggaggtactgc</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>U4<sup>5)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gctttgcgcagtggcagtatcg</p>
                     </c>
                     <c ca="left">
                        <p>cagtctccgtagagactgtcaaaaattg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>U6<sup>5)</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gtgctcgcttcggcagcacatatac</p>
                     </c>
                     <c ca="left">
                        <p>ggaacgcttcacgaatttgcg</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>1) Eppendorf cMaster RTplusPCR system (Eppendorf Inc. Westbury, NY)</p>
                  <p>2) Funaki et al. 2003 [54]</p>
                  <p>3) Onafuwa-Nuga et al. 2006 [28]</p>
                  <p>4) Chiu et al 2006 [22]</p>
                  <p>5) Giles et al. 2004 [41]</p>
               </tblfn>
            </tbl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Intracellular association of APO3G and host RNAs</p>
               </caption>
               <text>
                  <p>Intracellular association of APO3G and host RNAs. <b>(A) </b>Expression and immunoprecipitation of APO3G. HeLa cells (5 &#215; 10<sup>6</sup>) were transfected with 5 &#956;g of pcDNA-Apo3G-MycHis plasmid DNA. Cells were harvested 24 h post transfection. An aliquot of the transfected cells was used for the analysis of APO3G expression as follows: Cell lysates were immunoprecipitated with a polyclonal antibody to the myc epitope tag (&#945;-myc) or were mock immunoprecipitated (mock). Immunoprecipitated samples and total cell lysate (Total) were analyzed for the presence of APO3G by immunoblotting using an APO3G-specific polyclonal peptide antibody. <b>(B) </b>The remaining cells from above were used for RT-PCR analysis as follows: Total cellular RNA (Total) or RNA present in the immune complexes (&#945;-myc and mock, respectively) was extracted and used for RT-PCR analysis as described in Methods. Primer pairs were selected for the specific amplification of the RNAs as indicated on the left. Primer sequences are listed in table 1. All RT-PCR reactions were performed simultaneously to minimize experimental error. RT-PCR products were analyzed on 1% agarose gels and visualized by staining with ethidium bromide. <b>(C) </b>HeLa cells (5 &#215; 10<sup>6</sup>) were transfected with 5 &#956;g of pcDNA-Apo3G-MycHis plasmid DNA (lanes 1 &amp; 3) or 5 &#956;g of pcDNA-Apo3G (lanes 2 &amp; 4). Cells were harvested 24 h post transfection and analyzed as in panels A and B. <b>(D) </b>The specificity of the RT-PCR reaction was validated using 7SL RNA as a substrate. Total cellular RNA from panel B was either left untreated (-) or treated with RNase A (50 &#956;g/ml) for 60 min at 37&#176;C (+) prior to RT-PCR.</p>
               </text>
               <graphic file="1742-4690-4-48-1"/>
            </fig>
            <p>To rule out non-specific binding of RNAs to the myc-specific antibody in figure <figr fid="F1">1B</figr>, plasmids encoding epitope tagged or untagged APO3G were separately transfected into HeLa cells. Cell extracts were subjected to immunoblot analysis and RT-PCR as described for figure <figr fid="F1">1B</figr>. Myc-tagged and untagged APO3G were efficiently expressed in the transfected cells (Fig. <figr fid="F1">1C</figr>, top panel, lanes 1&#8211;2). As expected, untagged APO3G was not immunoprecipitated by the myc-specific antibody (Fig. <figr fid="F1">1C</figr>, top panel, lane 4) while epitope-tagged APO3G-MycHis was identified in the immune complexes (Fig. <figr fid="F1">1C</figr>, top panel, lane 3). A shorter form of APO3G-MycHis co-migrating with the untagged form of APO3G in figure <figr fid="F1">1C</figr> presumably represents C-terminally truncated protein missing part or all of the epitope tag as it was not recognized by epitope-tag-specific antibodies (data not shown). To test non-specific binding of RNA to the myc-specific antibody, we performed RT-PCR as described for figure <figr fid="F1">1B</figr> using 7SL-specific primers. As expected, 7SL RNA was identified in immune complexes of myc-tagged APO3G (Fig. <figr fid="F1">1C</figr>, lower panel, lane 3). However, 7SL RNA was not amplified by RT-PCR from samples containing untagged APO3G (Fig. <figr fid="F1">1C</figr>, lower panel, lane 4). These results demonstrate that the presence of 7SL RNA in immune complexes of myc-tagged APO3G was due to the presence of APO3G and not caused by non-specific binding of the RNA to the myc antibody. Finally, the RT-PCR reaction was sensitive to treatment with RNase A as exemplified by the lack of 7SL RNA amplification in RNase-treated samples (Fig. <figr fid="F1">1D</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Cellular RNAs are not sufficient to target APO3G into HIV-1 virions</p>
            </st>
            <p>Previous studies on murine and avian retroviruses found that these viruses encapsidate a variety of host RNAs <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B33">33</abbr><abbr bid="B43">43</abbr></abbrgrp>. More recent studies have similarly identified cellular RNAs in HIV-1 particles <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B32">32</abbr></abbrgrp>. The experiments described above are both consistent with our previous finding that APO3G has RNA binding properties in vitro <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> and other studies demonstrating association of APO3G with cellular RNAs as well as HIV-1 RNA <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B23">23</abbr></abbrgrp>. Furthermore, we and others previously reported that viral genomic RNA enhances the encapsidation of APO3G into HIV-1 virions <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B18">18</abbr></abbrgrp>. Contrasting these findings, other reports concluded that Gag is sufficient for the encapsidation of APO3G into VLP <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>. Interestingly, the APO3G-Gag interaction was found to be either RNA independent <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> or to be sensitive to RNase-treatment <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> and several studies concluded that nonspecific RNA was critical for APO3G packaging <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr></abbrgrp>. Thus, the parameters determining APO3G packaging into HIV-1 virions remained unclear and warranted further investigation.</p>
            <p>In our next experiment, we compared the packaging of APO3G and cellular RNAs into HIV-1 virions or VLP in an attempt to identify a possible correlation between APO3G packaging and encapsidation of cellular RNAs. Four types of particles were analyzed as shown in Fig. <figr fid="F2">2</figr>. All particles lacked a functional <it>vif </it>gene to prevent degradation of APO3G, which would make interpretation of our results more difficult. NL4-3&#916;Vif served as a positive control; C-Help&#916;Vif is a helper virus construct lacking both LTRs and carrying deletions in env and in the 5' untranslated region <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. C-Help&#916;Vif particles do not package detectable quantities of genomic RNA and we previously found that packaging of APO3G into C-Help&#916;Vif virions was impaired <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. The mS.1&#916;Vif construct carries mutations in stem-loop 1 of the 5' untranslated region of the viral RNA <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> mS.1&#916;Vif particles contain viral genomic RNA but are impaired in APO3G packaging due to the mutations in the stem loop 1 motif <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Finally, DB653&#916;Vif was included to control for the requirement of NC in RNA and APO3G packaging. DB653&#916;Vif was derived from DB653 <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B45">45</abbr></abbrgrp> and carries SSHS/SSHS mutations in the NC zinc finger motifs. The genomic RNA content of DB653 particles was reported to be less than 10% of wild type virus <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Schematic representation of constructs used in the study</p>
               </caption>
               <text>
                  <p>Schematic representation of constructs used in the study. Constructs are discussed in the text. All constructs carry an out-of-frame deletion in the vif gene as described previously [50]. The nucleotide changes in the stem portion of stem-loop 1 region in mS.1&#916;Vif and the alignment of wild type and DB653 zinc finger residues are shown.</p>
               </text>
               <graphic file="1742-4690-4-48-2"/>
            </fig>
            <p>Particles were produced by transfecting HeLa cells with appropriate plasmid DNAs in the presence of APO3G. Viruses were purified and concentrated as described in Methods. Aliquots were used for immunoblot analysis to determine viral protein content and to verify APO3G packaging (Fig. <figr fid="F3">3A</figr>). Other aliquots of the concentrated viruses were used to extract particle-associated RNA, which was then used for RT-PCR analysis (Fig. <figr fid="F3">3C</figr>). Consistent with our previous report, immunoblot analysis showed that NL4-3&#916;Vif packaged significantly higher amounts of APO3G than C-Help&#916;Vif and mS.1&#916;Vif particles (Fig. <figr fid="F3">3A</figr>). Packaging of APO3G was quantified by densitometric scanning of the APO3G bands. Results were corrected for fluctuations in capsid (CA) levels and are presented as percentage of APO3G packaged into NL4-3&#916;Vif particles, which was defined as 100% (Fig. <figr fid="F3">3B</figr>). Consistent with our previous data <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, packaging of APO3G into C-Help&#916;Vif and mS.1&#916;Vif particles was reduced to about 25&#8211;30% of wild type levels.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Correlation between cellular and viral RNA encapsidation and APO3G packaging</p>
               </caption>
               <text>
                  <p>Correlation between cellular and viral RNA encapsidation and APO3G packaging. HeLa cells were co-transfected with pcDNA-APO3G-MycHis together with <it>vif</it>-defective variants of either pNL4-3 (43&#916;Vif), pC-Help (C-Help&#916;Vif), or mS.1 (mS.1&#916;Vif). Viruses were harvested 24 h after transfection and purified as described in Methods. <b>(A) </b>Virus production and packaging of APO3G was monitored by immunoblot analysis using an aliquot of the purified, concentrated virus preparations. APO3G encapsidation was identified using a polyclonal APO3G-specific peptide antibody. Viral capsid proteins (CA) were identified using an HIV-positive human patient serum (APS). <b>(B) </b>APO3G-specific bands in panel A were quantified by densitometric scanning and corrected for fluctuations in capsid levels. Results were calculated relative to APO3G associated with NL4-3&#916;Vif particles, which was defined as 100%. <b>(C) </b>RNAs were extracted from purified, concentrated viruses and amplified by RT-PCR using primer pairs specific for HIV-1 RNA or host RNAs as indicated on the left and detailed in table 1. RT-PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.</p>
               </text>
               <graphic file="1742-4690-4-48-3"/>
            </fig>
            <p>Equal numbers of particles, as judged by reverse transcriptase activity, were used for extraction of RNA, which was then used for RT-PCR using a series of primers as shown in figure <figr fid="F3">3C</figr> and detailed in table <tblr tid="T1">1</tblr>. All RT-PCR reactions shown in figure <figr fid="F3">3C</figr> were done simultaneously. Amplification by an HIV-1 specific primer confirmed the presence of genomic RNA in NL4-3&#916;Vif and mS.1&#916;Vif particles and verified the lack of detectable amounts of genomic RNA in C-Help&#916;Vif preparations (Fig. <figr fid="F3">3C</figr>, HIV-1). In contrast, amplification of 7SL RNA as well as &#946;-actin, GAPDH, and &#945;-tubulin mRNAs yielded comparable amounts of PCR products indicative of the presence of similar levels of these cellular RNAs in all three particle preparations. These results suggest that packaging of these RNAs was independent of the presence or absence of viral genomic RNA (Fig. <figr fid="F3">3C</figr>). Similarly, U1, U2, U4, and U6 small nuclear RNAs were amplified with similar efficiency from all three particle preparations. while human Y5 RNA was virtually absent from the particles. On the other hand, hY1, hY3, and hY4 RNAs appeared to be packaged more efficiently into C-Help&#916;Vif particles than into NL4-3&#916;Vif and mS.1&#916;Vif virions. The less efficient packaging of hY1, hY3, and hY4 RNAs into NL4-3&#916;Vif and mS.1&#916;Vif particles is unrelated to APO3G encapsidation as APO3G levels in mS.1&#916;Vif particles were as low as in C-Help&#916;Vif (Fig. <figr fid="F3">3A</figr> &amp;<figr fid="F3">3B</figr>). Importantly, there was no obvious correlation between APO3G packaging and encapsidation of any of the tested cellular RNAs.</p>
         </sec>
         <sec>
            <st>
               <p>Packaging of hY RNAs requires the NC zinc finger domains</p>
            </st>
            <p>The increased packaging of hY RNAs into particles lacking genomic RNA could indicate a competitive mechanism in which viral genomic RNA competes for a common packaging domain. Since viral genomic RNA is packaged through an interaction with the NC zinc finger domain, we investigated the impact of zinc finger mutations on the packaging of hY RNAs. In addition, we assessed the impact of zinc finger mutations on the packaging of genomic RNA and 7SL RNA as well as APO3G (Fig. <figr fid="F4">4</figr>). NL4-3&#916;Vif and DB653&#916;Vif particles were produced from transfected HeLa cells as described for figure <figr fid="F3">3</figr>. Cell lysates and concentrated cell-free virions were subjected to immunoblot analysis to verify comparable amounts of viral Gag proteins and to assess the encapsidation of APO3G into NC zinc finger mutant particles. Consistent with previous reports <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp> we found that mutation of the NC zinc finger domain abolished packaging of APO3G into virus-like particles (Fig. <figr fid="F4">4A</figr>, DB653&#916;Vif).</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Packaging of hY RNAs requires the NC zinc finger domains</p>
               </caption>
               <text>
                  <p>Packaging of hY RNAs requires the NC zinc finger domains. HeLa cells were co-transfected with pcDNA-APO3G-MycHis together with pNL4-3&#916;Vif (43&#916;Vif) or pDB653&#916;Vif. Viruses were harvested 24 h after transfection and purified as described in Methods. <b>(A) </b>Virus production and packaging of APO3G was monitored by immunoblot analysis using an aliquot of the purified, concentrated virus preparations. APO3G encapsidation was identified using a polyclonal APO3G-specific peptide antibody. Viral capsid proteins (CA) were identified using an HIV-positive human patient serum (APS). <b>(B) </b>RNAs were extracted from purified, concentrated viruses and amplified by RT-PCR using primer pairs specific for HIV-1 RNA or host RNAs as indicated on the left and detailed in table 1. RNA extracted from C-Help&#916;Vif preparations in figure 3 was included as control. RT-PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.</p>
               </text>
               <graphic file="1742-4690-4-48-4"/>
            </fig>
            <p>For RT-PCR analysis, C-Help&#916;Vif RNA from figure <figr fid="F3">3C</figr> was included for comparison. As before particles were normalized for equal reverse transcriptase activity. RT-PCR analysis using HIV-1-specific primers confirmed the absence of viral genomic RNA in C-Help&#916;Vif and the DB653&#916;Vif zinc finger mutant (Fig. <figr fid="F4">4B</figr>). As before, hY5 RNA was virtually absent from all particle preparations including the zinc finger mutant. Interestingly, packaging of 7SL RNA was not affected by mutation of the NC zinc fingers suggesting that 7SL RNA is packaged in an NC-independent manner. In contrast, packaging of hY1, hY3, and hY4 RNAs was critically dependent on intact NC zinc finger domains (Fig. <figr fid="F4">4B</figr>). Thus, packaging of hY RNAs is indeed NC-dependent and the absence of hY RNAs from NL4-3&#916;Vif particles is best explained by competitive binding of viral genomic RNA and hY RNA to NC.</p>
         </sec>
         <sec>
            <st>
               <p>7SL RNA does not promote SRP54 encapsidation</p>
            </st>
            <p>7SL RNA (also referred to as SRP RNA) is a component of the signal recognition particle (SRP), which is critical for the targeting of nascent secretory and membrane proteins to the endoplasmic reticulum membrane (for review see <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>). SRP54 is one of six protein subunits that constitute mammalian SRPs and is responsible for high affinity assembly of 7SL RNA into the SRP complex (reviewed in <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>). Given the fact that 7SL RNA was efficiently packaged into HIV-1 virions, we wanted to test whether intracellular high affinity 7SL RNA-SRP54 interactions would result in the recruitment of SRP54 rather than APO3G into HIV-1 virions.</p>
            <p>First, we verified the association of 7SL RNA with SRP54 in normal HeLa cells. For that purpose, HeLa cell lysates were adsorbed to SRP54 reactive autoantibodies and immunoprecipitation of SRP54 was confirmed by immunoblotting using an SRP54-specific antibody (Fig. <figr fid="F5">5A</figr>, top panel, SRP). The specificity of the reaction was verified by the absence of SRP54 protein in mock-immunoprecipitated samples (Fig. <figr fid="F5">5A</figr>, mock) and by the absence of &#945;-tubulin in SRP54-specific and mock precipitates (Fig. <figr fid="F5">5A</figr>, middle panel). Total RNA extracted from the immunoprecipitates revealed the presence of 7SL RNA in SRP54-specific but not in mock immunoprecipitated samples (Fig. <figr fid="F5">5A</figr>, lower panel).</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>7SL RNA interaction is insufficient for incorporation of SRP54 protein into HIV-1 particles</p>
               </caption>
               <text>
                  <p>7SL RNA interaction is insufficient for incorporation of SRP54 protein into HIV-1 particles. <b>(A) </b>Cell lysates of untransfected HeLa cells were immunoprecipitated with an SRP54-specific antibody (IP) or were mock-precipitated (Ctrl). Aliquots of total cell lysate (Total) and immunoprecipitates were subjected to immunoblot analysis using antibodies to SRP54 (&#945;-SRP54), &#945;-tubulin (&#945;-tubulin). RNA was extracted from remaining cell lysate and immunoprecipitates and used for RT-PCR amplification of 7SL RNA. <b>(B) </b>HeLa cells were transfected <it>vif</it>-defective variants of either pNL4-3 (43&#916;Vif), pC-Help (C-Help&#916;Vif, or mS.1 (mS.1&#916;Vif). Transfected cells and virus-containing supernatants were harvested 24 h after transfection. Virus-containing supernatants were purified and concentrated as described in Methods. Cell and viral lysates were analyzed by immunoblotting for virus production using an HIV-positive patient serum (APS). Expression and packaging of SRP54 was analyzed using an SRP54-specific antibody o&#945;-SRP54). Total cellular RNA and RNA extracted from concentrated viruses was used for RT-PCR amplification of 7SL RNA.</p>
               </text>
               <graphic file="1742-4690-4-48-5"/>
            </fig>
            <p>Next, the packaging of SRP54 protein into HIV-1 virions was tested. Virus particles were produced as described for figure <figr fid="F3">3</figr> except that APO3G was omitted in these samples. Cell lysates and concentrated virus preparations were used for immunoblotting and for RT-PCR analysis as described for figure <figr fid="F3">3</figr>. The results are shown in figure <figr fid="F5">5B</figr>. All cell lysates contained equal amounts of SRP54 and viral capsid proteins as well as 7SL RNA (Fig. <figr fid="F5">5B</figr>, cell). Furthermore, all samples produced comparable amounts of cell-free virions as judged from the immunoblot (Fig. <figr fid="F5">5B</figr>, CA) and packaged comparable amounts of 7SL RNA (Fig. <figr fid="F5">5B</figr>, 7SL). Of note, SRP54 was virtually absent from the virus preparations (Fig. <figr fid="F5">5B</figr>, SRP54), thus confirming and extending a recent study that also did not find SRP54 protein in HIV-1 virions <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. These results demonstrate that intracellular RNA-protein interactions are not a predictor for subsequent targeting of the proteins into viral particles.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>There is general agreement in the literature that APO3G can severely impair replication of HIV-1 and other primate lentiviruses lacking functional Vif proteins. It is also uncontested that the antiviral activity of APO3G &#8211; with the notable exception of resting CD4+ T cells <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> &#8211; requires the encapsidation of APO3G into nascent virions (for review see <abbrgrp><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr></abbrgrp>). However, the mechanism of APO3G encapsidation is not fully understood. <it>In vitro </it>studies demonstrated the ability of APO3G to interact with viral Gag protein and the nucleocapsid region of the viral Gag precursor was identified as the likely APO3G binding site <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>. Consistent with this model, studies on virus-like particles demonstrated efficient packaging of APO3G in the absence of viral genomic RNA <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp> although some of these studies proposed that non-specific cellular RNA may contribute to APO3G encapsidation <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>. Our own data confirm the importance of NC for encapsidation as APO3G was not encapsidated into a zinc finger mutant (Fig. <figr fid="F4">4</figr>). The absence of APO3G from DB653&#916;Vif particles combined with the presence of low levels of APO3G in C-Help&#916;Vif virions (Fig. <figr fid="F3">3</figr>) suggests that APO3G/NC interactions &#8211; either with or without support from NC-dependent cellular RNAs &#8211; are sufficient for low level packaging of APO3G into virus-like particles. However, the presence of genomic RNA invariably increased the efficiency of APO3G packaging (Figs. <figr fid="F3">3</figr> &amp;<figr fid="F4">4</figr>). Importantly, our previous analysis of helper virus-associated APO3G demonstrated that APO3G packaged through genomic RNA-independent mechanism(s) is sensitive to detergent treatment and thus most likely not associated with the viral nucleoprotein complex <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>.</p>
         <p>The current study was stimulated by recent reports on the presence of cellular 7SL RNA and snRNAs in HIV-1 virions or retroviral particles <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B32">32</abbr><abbr bid="B41">41</abbr></abbrgrp> as well as the characterization of cellular RNAs associated with intracellular APO3G <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B23">23</abbr></abbrgrp>. Our goal was to test the possible contribution of these or other host RNAs towards the packaging of APO3G into HIV-1 particles. Of the four hY RNAs previously identified in APO3G complexes <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>, hY3 was clearly identified in APO3G complexes while hY1 and hY4 only weakly interacted with APO3G in our analysis (Fig. <figr fid="F1">1B</figr>). Among the snRNAs tested, only U6 clearly co-purified with APO3G complexes and U4 showed weak interaction. This finding is interesting since U6 snRNA localizes primarily to the nucleus and does not have a known cytoplasmic function. Surprisingly &#946;-actin mRNA, which was previously reported to be absent from APO3G complexes <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B23">23</abbr></abbrgrp> as well as GADPH mRNA clearly co-purified with APO3G in our study. In contrast, we confirmed that &#945;-tubulin mRNA only poorly associated with APO3G. The reasons for these discrepancies are not clear and could be due to differences in experimental conditions. Importantly, however, most RNAs tested in our study were packaged into NL4-3&#916;Vif virions as well as helper virus and mS.1&#916;Vif particles (Fig. <figr fid="F3">3C</figr>). Interestingly, comparative RT-PCR analysis demonstrated that hY1, hY3, and hY4 RNAs were more efficiently packaged into C-Help&#916;Vif particles lacking viral genomic RNA than into particles containing viral genomic RNA (Fig. <figr fid="F3">3C</figr>). Subsequent analysis of an NC mutant revealed that these hY RNAs are packaged through an NC-dependent mechanism. Thus, their inefficient packaging into NL4-3&#916;Vif and mS.1&#916;Vif particles may be explained by competitive binding of viral genomic RNA to NC.</p>
         <p>U6 snRNA was previously identified in RSV particles <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. Interestingly, however, U1, U2, and U4 snRNA, all of which were identified in our HIV preparations, were either absent from RSV particles or only present in trace amounts <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. While it is possible that RSV and HIV differ in the packaging of cellular RNAs, it is also possible that the greater sensitivity of the RT-PCR approach used in our study versus the northern blot analysis employed in the RSV analysis contributed to the different findings. Of note, 7SL RNA despite being packaged in molar excess relative to viral genomic RNA <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> did not promote the packaging of SRP54 protein (Fig. <figr fid="F3">3B</figr>) consistent with a recent report <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Thus, despite the high affinity interaction of 7SL RNA with SRP54, such intracellular interaction was insufficient to promote packaging of SRP54 into cell-free virions. Similarly, packaging of RNAs previously found in association with intracellular APO3G complexes was insufficient to support APO3G encapsidation. Thus, we did not observe a correlation between the packaging of cellular RNAs into HIV-1 particles and encapsidation of APO3G. The exclusion of APO3G from C-Help&#916;Vif particles lacking genomic RNA but containing high levels of cellular RNAs and the absence of APO3G from mS.1&#916;Vif particles containing genomic RNA with mutations in the stem-loop 1 region of the 5' untranslated region point to a role of viral genomic RNA in the packaging of APO3G. We cannot formally rule out that other, thus far unidentified cellular RNA species contribute to the packaging of APO3G into virus particles; however, this seems unlikely since we would have to posit that such RNAs are specifically excluded from C-Help&#916;Vif and mS.1&#916;Vif particles.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We have demonstrated that <it>vif</it>-defective HIV-1 particles package a variety of cellular RNAs. Most of the cellular RNAs tested, except hY RNAs, were packaged independent of viral genomic RNA. Packaging of hY RNAs was NC-dependent and inhibited by viral genomic RNA. In all experiments, APO3G packaging correlated well with the presence of viral genomic RNA but not with the presence of any of the cellular RNAs tested. Thus, our data do not support a model in which APO3G is packaged through non-specific or specific interaction with cellular RNAs. In particular, we can rule out that packaging of 7SL RNA is sufficient for the encapsidation of APO3G. Instead, we propose that packaging of APO3G into virus particles is mediated through interaction with viral genomic RNA.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Plasmids</p>
            </st>
            <p>The <it>vif</it>-defective molecular clone pNL4-3&#916;Vif <abbrgrp><abbr bid="B50">50</abbr></abbrgrp> was used for the production of <it>vif</it>-defective HIV-1 virus stocks. Plasmid pC-Help&#916;Vif was used for the production of <it>vif</it>-defective &#936;<sup>- </sup>virus-like particles (VLP). These particles contain undetectable levels of viral genomic RNA <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Plasmid pNL4-3mS.1&#916;Vif carries mutations in stem-loop 1 of the 5'-untranslated region <abbrgrp><abbr bid="B51">51</abbr></abbrgrp> and was constructed by subcloning the mutated stem-loop 1 region into the <it>vif</it>-defective pNL4-3 vector <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. NL4-3mS.1&#916;Vif particles are &#936;<sup>+ </sup>but do not support the encapsidation of APO3G <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. A <it>vif</it>-defective variant of DB653 <abbrgrp><abbr bid="B45">45</abbr></abbrgrp> was constructed by transferring the Gag region of DB653 into pNL4-3Vif(-) using standard cloning techniques. The structures of these constructs are schematically shown in figure <figr fid="F2">2</figr>. Construction of pcDNA-Apo3G-MycHis for the expression of C-terminally epitope-tagged wild type human APO3G proteins was described previously <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> and untagged version, pcDNA-Apo3G, was construction by introducing a stop coding at the end of the APO3G gene <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Tissue culture and transfection</p>
            </st>
            <p>HeLa cells, which do not express endogenous APO3G, were propagated in Dulbecco's modified Eagles medium (DMEM) containing 10% fetal bovine serum (FBS). For transfection, HeLa cells were grown in 25 cm<sup>2 </sup>flasks to about 80% confluency. Cells were transfected using LipofectAMINE PLUS&#8482; (Invitrogen Corp, Carlsbad CA) following the manufacturer's recommendations. A total of 5 &#956;g of plasmid DNA per 25 cm<sup>2 </sup>flask (5 &#215; 10<sup>6 </sup>cells) was generally used. Cells were harvested 24 h post transfection.</p>
         </sec>
         <sec>
            <st>
               <p>Preparation of virus stocks</p>
            </st>
            <p>Virus stocks were prepared by transfecting HeLa cells with pNL4-3&#916;Vif, pC-Help&#916;Vif, or pNL4-3mS.1&#916;Vif DNAs in the presence or absence of APO3G expression vector as indicated in the text. Virus-containing supernatants were harvested 24 h after transfection. Cellular debris was removed by centrifugation (5 min, 1500 rpm) and clarified supernatants were filtered (0.45 &#956;m) to remove residual cellular contaminants. For immunoblot analysis of viral proteins and RNA extraction, virus-containing supernatants (7 ml) were concentrated by ultracentrifugation through 2 ml of 20% sucrose in PBS as described previously <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Antisera</p>
            </st>
            <p>APO3G was identified using a polyclonal rabbit serum against a synthetic peptide comprising the 17 C-terminal residues of APO3G. Serum from an HIV-positive patient (APS) was used to detect HIV-1-specific capsid (CA) proteins. Tubulin was identified using an &#945;-tubulin-specific monoclonal antibody (Sigma-Aldrich, Inc., St. Louis MO). SRP54 protein was detected with a SRP54-specific monoclonal antibody (BD Biosciences, San Jose, CA). Immunoprecipitation of APO3G was done using a polyclonal antibody raised against the myc tag (Sigma-Aldrich, Inc., St. Louis, MO). A human SRP54-reactive autoimmune serum was used for immunoprecipitation of SRP54 protein (kind gift of Frederick W. Miller, NIEHS, NIH, Bethesda, MD, USA).</p>
         </sec>
         <sec>
            <st>
               <p>Immunoblotting</p>
            </st>
            <p>HeLa cells transfected with APO3G were used to detect cellular APO3G expression and untransfected HeLa cells were used for the detection of endogenous SRP54 protein by immunoblotting with appropriate antibodies. For immunoblot analysis of cellular proteins, whole cell lysates were prepared as follows. Cells were washed once with PBS, suspended in 450 &#956;l/10<sup>7 </sup>cells with X-100 lysis buffer (50 mM Tris-HCL pH7.5, 150 mM NaCl, 0.5% Triton X-100). For Western blot analysis 50 &#956;l aliquot was taken and mixed with equal volume of sample buffer (4% sodium dodecyl sulfate [SDS], 25 mM Tris-HCL, pH 6.8, 10% 2-mercaptoethanol, 10% glycerol, and 0.002% bromphenol blue). Proteins were solubilized by boiling for 5 min at 95&#176;C with occasional vortexing of the samples to shear chromosomal DNA. Residual insoluble material was removed by centrifugation (2 min, 15,000 rpm in an Eppendorf Minifuge). For immunoblot analysis of virus-associated proteins, concentrated viral pellets were suspended in a 1:1 mixture of PBS and sample buffer and boiled. Cell lysates and viral extracts were subjected to SDS-polyacrylamide gel electrophoresis; proteins were transferred to polyvinylidene difluoride membranes and reacted with appropriate antibodies as described in the text. Membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies (Amersham Bioscience, Piscataway, NJ) and visualized by enhanced chemiluminescence (Amersham Bioscience).</p>
         </sec>
         <sec>
            <st>
               <p>Immunoprecipitation analysis</p>
            </st>
            <p>HeLa cells were transfected with pcDNA-APO3G-MycHis. Cells were harvested at 24 h post transfection cell lysates were prepared as follows: Cells were divided into two unequal fractions (30% and 70%). The larger fraction was used for immunoprecipitation studies and the smaller fraction was used for RNA extraction (see below). For immunoprecipitation, cells were washed once with PBS and lysed in 450 &#956;l of lysis buffer (50 mM Tris, pH7.5, 150 mM, NaCl 0.5% and Triton X-100). The cell extracts were clarified by centrifugation (13,000 &#215; g, 3 min) and the supernatant was incubated on a rotating wheel for 1 h at 4&#176;C with protein A-Sepharose beads (Sigma-Aldrich, Inc., St. Louis MO) coupled with (IP) or without (Ctrl) anti-myc rabbit polyclonal antibody (Sigma-Aldrich, Inc., St. Louis MO). Immunocomplexes were washed three times with wash buffer (50 mM Tris, 300 mM NaCl, and 0.1% Triton X-100 (pH 7.4). Bound proteins were eluted form beads by heating in sample buffer for 5 min at 95&#176;C and analyzed by immunoblotting using antibodies as indicated in the text. For immunoprecipitation of APO3G-RNA complexes, cell extracts were subjected to immunoprecipitation by antibody covered beads or control beads as described above and washed three times with RNA-protein binding buffer (20 mM HEPES, 25 mM KCl, 7 mM 2-Mercaptoethanol, 5% Glycerol and 0.1% NP-40). Bound RNA was then extracted as described below.</p>
         </sec>
         <sec>
            <st>
               <p>RNA extraction</p>
            </st>
            <p>Total cellular RNA was extracted from untransfected and transfected HeLa cells using the RNeasy RNA extraction kit (QIAGEN, Valencia, CA) following the manufacturer's instructions. To isolate RNA from immunocomplexes, beads were washed three times with RNA-protein binding buffer (20 mM HEPES, 25 mM KCl, 7 mM 2-Mercaptoethanol, 5% Glycerol and 0.1% NP-40). RNA was then extracted using RNeasy RNA extraction kit. For isolation of SRP54-associated RNA, SRP54 was precipitated with SRP54-reactive human autoantibodies derived from a patient with polymyositis (<abbrgrp><abbr bid="B53">53</abbr></abbrgrp>; gift of Frederick W Miller, NIEHS, NIH, Bethesda, MD, USA). RNA was then extracted from the immunocomplexes as before</p>
         </sec>
         <sec>
            <st>
               <p>RT-PCR</p>
            </st>
            <p>RNA extracted from cells, viruses, or immunocomplexes was treated with RNase-free DNase I (10 units, 30 min, 37&#176;C) prior to the RT-PCR reaction. RNA concentrations were determined by spectrophotometry. RT-PCR was performed using equal amounts of RNA and the one-step RT-PCR kit (QIAGEN, Valencia, CA) according to the manufacturer's instruction. Primers for the amplification of specific RNAs are listed in table <tblr tid="T1">1</tblr>. RNA was first reverse transcribed at 50&#176;C for 30 minutes followed by 30 PCR cycles (denaturation at 94&#176;C; 15 sec; annealing at 55&#176;C, 30 sec; and extension at 72&#176;C, 1 min) and one 10-minute extension cycle at 72&#176;C. RT-PCR products were mixed with DNA loading buffer (EDTA 20 mM, TAE 5&#215;, Glycerol 50% and 0.002% Bromphenol Blue dye), electrophoresed in 1% agarose gels, and visualized by staining with ethidium bromide. A DNA size marker was run in parallel.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>M.K. conceived the study, was leading the execution of the experiments, and participated in the writing of the manuscript. K.S. coordinated and supervised the study and was involved in the writing of the manuscript. R.G., S.O., E.M., H.T., and S.K. participated in virus production and sample preparation and provided critical comments on the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We are grateful to Frederick Miller (NIEHS, NIH) for providing SRP54-reactive human autoimmune serum. We thank Jared Clever and Tristram Parslow for the mS.1 mutant. Plasmid DB653 was a generous gift of Robert Gorelick (AIDS Vaccine Research Program, NCI). Part of this work was supported by a grant from the NIH Intramural AIDS Targeted Antiviral Program to K.S. and by the Intramural Research Program of the NIH, NIAID to K.S.</p>
            <p>Table Refs <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B28">28</abbr><abbr bid="B41">41</abbr><abbr bid="B54">54</abbr></abbrgrp></p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Evolution of the AID/APOBEC family of polynucleotide (deoxy)cytidine deaminases</p>
            </title>
            <aug>
               <au>
                  <snm>Conticello</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Petersen-Mahrt</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Neuberger</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2005</pubdate>
            <volume>22</volume>
            <fpage>367</fpage>
            <lpage>377</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msi026</pubid>
                  <pubid idtype="pmpid" link="fulltext">15496550</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>An anthropoid-specific locus of orphan C to U RNA-editing enzymes on chromosome 22</p>
            </title>
            <aug>
               <au>
                  <snm>Jarmuz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Chester</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bayliss</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gisbourne</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dunham</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Navaratnam</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>2002</pubdate>
            <volume>79</volume>
            <fpage>285</fpage>
            <lpage>296</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/geno.2002.6718</pubid>
                  <pubid idtype="pmpid" link="fulltext">11863358</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>APOBEC4, a New Member of the AID/APOBEC Family of Polynucleotide (Deoxy)cytidine Deaminases Predicted by Computational Analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Rogozin</snm>
                  <fnm>IB</fnm>
               </au>
               <au>
                  <snm>Basu</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Jordan</snm>
                  <fnm>IK</fnm>
               </au>
               <au>
                  <snm>Pavlov</snm>
                  <fnm>YI</fnm>
               </au>
               <au>
                  <snm>Koonin</snm>
                  <fnm>EV</fnm>
               </au>
            </aug>
            <source>Cell Cycle</source>
            <pubdate>2005</pubdate>
            <volume>4</volume>
            <fpage>1281</fpage>
            <lpage>1285</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16082223</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Messenger RNA editing in mammals: new members of the APOBEC family seeking roles in the family business</p>
            </title>
            <aug>
               <au>
                  <snm>Wedekind</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Dance</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Sowden</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>HC</fnm>
               </au>
            </aug>
            <source>Trends Genet</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>207</fpage>
            <lpage>216</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-9525(03)00054-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">12683974</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Species-specific exclusion of APOBEC3G from HIV-1 v irions by Vif</p>
            </title>
            <aug>
               <au>
                  <snm>Mariani</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schrofelbauer</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Navarro</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Konig</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Bollman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Munk</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Nymark-McMahon</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Landau</snm>
                  <fnm>NR</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2003</pubdate>
            <volume>114</volume>
            <fpage>21</fpage>
            <lpage>31</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(03)00515-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">12859895</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>HIV-1 Vif protein binds the editing enzyme APOBEC3G and induces its degradation</p>
            </title>
            <aug>
               <au>
                  <snm>Marin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rose</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Kozak</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Kabat</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>2003</pubdate>
            <volume>9</volume>
            <fpage>1398</fpage>
            <lpage>1403</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm946</pubid>
                  <pubid idtype="pmpid" link="fulltext">14528301</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>The human immunodeficiency virus type 1 Vif p rotein reduces intracellular expression and inhibits packaging of APOBEC3G (CEM15), a cellular inhibitor of virus infectivity</p>
            </title>
            <aug>
               <au>
                  <snm>Kao</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Khan</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Miyagi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Plishka</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Buckler-White</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Strebel</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2003</pubdate>
            <volume>77</volume>
            <fpage>11398</fpage>
            <lpage>11407</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">229358</pubid>
                  <pubid idtype="pmpid" link="fulltext">14557625</pubid>
                  <pubid idtype="doi">10.1128/JVI.77.21.11398-11407.2003</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Induction of APOBEC3G ubiquitination and degradation by an HIV-1 Vif-Cul5-SCF complex</p>
            </title>
            <aug>
               <au>
                  <snm>Yu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Luo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kong</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Mao</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>XF</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2003</pubdate>
            <volume>302</volume>
            <fpage>1056</fpage>
            <lpage>1060</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1089591</pubid>
                  <pubid idtype="pmpid" link="fulltext">14564014</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>APOBEC3G incorporation into human immunodeficiency virus type 1 particles</p>
            </title>
            <aug>
               <au>
                  <snm>Zennou</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Perez-Caballero</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Gottlinger</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bieniasz</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2004</pubdate>
            <volume>78</volume>
            <fpage>12058</fpage>
            <lpage>12061</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">523273</pubid>
                  <pubid idtype="pmpid" link="fulltext">15479846</pubid>
                  <pubid idtype="doi">10.1128/JVI.78.21.12058-12061.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts</p>
            </title>
            <aug>
               <au>
                  <snm>Mangeat</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Turelli</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Caron</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Friedli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Perrin</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Trono</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2003</pubdate>
            <volume>424</volume>
            <fpage>99</fpage>
            <lpage>103</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature01709</pubid>
                  <pubid idtype="pmpid" link="fulltext">12808466</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Human apolipoprotein B mRNA-editing enzyme-catalytic polypeptide-like 3G (APOBEC3G) is incorporated into HIV-1 virions through interactions with viral and nonviral RNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Svarovskaia</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Mbisa</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Barr</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gorelick</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Ono</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Freed</snm>
                  <fnm>EO</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Pathak</snm>
                  <fnm>VK</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <fpage>35822</fpage>
            <lpage>35828</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M405761200</pubid>
                  <pubid idtype="pmpid" link="fulltext">15210704</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>APOBEC3G is incorporated into virus-like particles by a direct interaction with HIV-1 Gag nucleocapsid protein</p>
            </title>
            <aug>
               <au>
                  <snm>Alce</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Popik</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <fpage>34083</fpage>
            <lpage>34086</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.C400235200</pubid>
                  <pubid idtype="pmpid" link="fulltext">15215254</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>The interaction between HIV-1 Gag and APOBEC3G</p>
            </title>
            <aug>
               <au>
                  <snm>Cen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Guo</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Niu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Saadatmand</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Deflassieux</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kleiman</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <fpage>33177</fpage>
            <lpage>33184</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M402062200</pubid>
                  <pubid idtype="pmpid" link="fulltext">15159405</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Specific packaging of APOBEC3G into HIV-1 virions is mediated by the nucleocapsid domain of the gag polyprotein precursor</p>
            </title>
            <aug>
               <au>
                  <snm>Schafer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bogerd</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Cullen</snm>
                  <fnm>BR</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2004</pubdate>
            <volume>328</volume>
            <fpage>163</fpage>
            <lpage>168</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virol.2004.08.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">15464836</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>HIV-1 and MLV Gag proteins are sufficient to recruit APOBEC3G into virus-like particles</p>
            </title>
            <aug>
               <au>
                  <snm>Douaisi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dussart</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Courcoul</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bessou</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Vigne</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Decroly</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2004</pubdate>
            <volume>321</volume>
            <fpage>566</fpage>
            <lpage>573</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2004.07.005</pubid>
                  <pubid idtype="pmpid" link="fulltext">15358144</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Amino-terminal region of the human immunodeficiency virus type 1 nucleocapsid is required for human APOBEC3G packaging</p>
            </title>
            <aug>
               <au>
                  <snm>Luo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Xiao</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Gorelick</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>XF</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2004</pubdate>
            <volume>78</volume>
            <fpage>11841</fpage>
            <lpage>11852</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">523292</pubid>
                  <pubid idtype="pmpid" link="fulltext">15479826</pubid>
                  <pubid idtype="doi">10.1128/JVI.78.21.11841-11852.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>APOBEC3G Multimers Are Recruited to the Plasma Membrane for Packaging into Human Immunodeficiency Virus Type 1 Virus-Like Particles in an RNA-Dependent Process Requiring the NC Basic Linker</p>
            </title>
            <aug>
               <au>
                  <snm>Burnett</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Spearman</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2007</pubdate>
            <volume>81</volume>
            <fpage>5000</fpage>
            <lpage>5013</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1128/JVI.02237-06</pubid>
                  <pubid idtype="pmpid" link="fulltext">17344295</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Viral RNA is required for the association of APOBEC3G with human immunodeficiency virus type 1 nucleoprotein complexes</p>
            </title>
            <aug>
               <au>
                  <snm>Khan</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Kao</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Miyagi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Takeuchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Goila-Gaur</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Opi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gipson</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Parslow</snm>
                  <fnm>TG</fnm>
               </au>
               <au>
                  <snm>Ly</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Strebel</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2005</pubdate>
            <volume>79</volume>
            <fpage>5870</fpage>
            <lpage>5874</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1082784</pubid>
                  <pubid idtype="pmpid" link="fulltext">15827203</pubid>
                  <pubid idtype="doi">10.1128/JVI.79.9.5870-5874.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>The anti-HIV-1 editing enzyme APOBEC3G binds HIV-1 RNA and messenger RNAs that shuttle between polysomes and stress granules</p>
            </title>
            <aug>
               <au>
                  <snm>Kozak</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Marin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rose</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Bystrom</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kabat</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2006</pubdate>
            <volume>281</volume>
            <fpage>29105</fpage>
            <lpage>29119</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M601901200</pubid>
                  <pubid idtype="pmpid" link="fulltext">16887808</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Newly synthesized APOBEC3G is incorporated into HIV virions, inhibited by HIV RNA, and subsequently activated by RNase H</p>
            </title>
            <aug>
               <au>
                  <snm>Soros</snm>
                  <fnm>VB</fnm>
               </au>
               <au>
                  <snm>Yonemoto</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Greene</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>PLoS Pathog</source>
            <pubdate>2007</pubdate>
            <volume>3</volume>
            <fpage>e15</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1796622</pubid>
                  <pubid idtype="pmpid" link="fulltext">17291161</pubid>
                  <pubid idtype="doi">10.1371/journal.ppat.0030015</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Biochemical Activities of Highly Purified, Catalytically Active Human APOBEC3G: Correlation with Antiviral Effect</p>
            </title>
            <aug>
               <au>
                  <snm>Iwatani</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Takeuchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Strebel</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Levin</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2006</pubdate>
            <volume>80</volume>
            <fpage>5992</fpage>
            <lpage>6002</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1472592</pubid>
                  <pubid idtype="pmpid" link="fulltext">16731938</pubid>
                  <pubid idtype="doi">10.1128/JVI.02680-05</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Cellular APOBEC3G restricts HIV-1 infection in resting CD4+ T cells</p>
            </title>
            <aug>
               <au>
                  <snm>Chiu</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Soros</snm>
                  <fnm>VB</fnm>
               </au>
               <au>
                  <snm>Kreisberg</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Stopak</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yonemoto</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Greene</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2005</pubdate>
            <volume>435</volume>
            <fpage>108</fpage>
            <lpage>114</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature03493</pubid>
                  <pubid idtype="pmpid" link="fulltext">15829920</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>High-molecular-mass APOBEC3G complexes restrict Alu retrotransposition</p>
            </title>
            <aug>
               <au>
                  <snm>Chiu</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Witkowska</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Santiago</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Soros</snm>
                  <fnm>VB</fnm>
               </au>
               <au>
                  <snm>Esnault</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Heidmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Greene</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2006</pubdate>
            <volume>103</volume>
            <fpage>15588</fpage>
            <lpage>15593</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1592537</pubid>
                  <pubid idtype="pmpid" link="fulltext">17030807</pubid>
                  <pubid idtype="doi">10.1073/pnas.0604524103</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Identification of a packaged cellular mRNA in virions of rous sarcoma virus</p>
            </title>
            <aug>
               <au>
                  <snm>Adkins</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hunter</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1981</pubdate>
            <volume>39</volume>
            <fpage>471</fpage>
            <lpage>480</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">171357</pubid>
                  <pubid idtype="pmpid" link="fulltext">6268836</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Specificity of retroviral RNA packaging</p>
            </title>
            <aug>
               <au>
                  <snm>Aronoff</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Linial</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1991</pubdate>
            <volume>65</volume>
            <fpage>71</fpage>
            <lpage>80</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">240490</pubid>
                  <pubid idtype="pmpid" link="fulltext">1985218</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>RNA packaging</p>
            </title>
            <aug>
               <au>
                  <snm>Berkowitz</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Goff</snm>
                  <fnm>SP</fnm>
               </au>
            </aug>
            <source>Curr Top Microbiol Immunol</source>
            <pubdate>1996</pubdate>
            <volume>214</volume>
            <fpage>177</fpage>
            <lpage>218</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8791728</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Nonrandom packaging of host RNAs in moloney murine leukemia virus</p>
            </title>
            <aug>
               <au>
                  <snm>Onafuwa-Nuga</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>King</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Telesnitsky</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2005</pubdate>
            <volume>79</volume>
            <fpage>13528</fpage>
            <lpage>13537</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1262605</pubid>
                  <pubid idtype="pmpid" link="fulltext">16227273</pubid>
                  <pubid idtype="doi">10.1128/JVI.79.21.13528-13537.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>7SL RNA, but not the 54-kd signal recognition particle protein, is an abundant component of both infectious HIV-1 and minimal virus-like particles</p>
            </title>
            <aug>
               <au>
                  <snm>Onafuwa-Nuga</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Telesnitsky</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>King</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>RNA</source>
            <pubdate>2006</pubdate>
            <volume>12</volume>
            <fpage>542</fpage>
            <lpage>546</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1421090</pubid>
                  <pubid idtype="pmpid" link="fulltext">16489186</pubid>
                  <pubid idtype="doi">10.1261/rna.2306306</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>RNA is a structural element in retrovirus particles</p>
            </title>
            <aug>
               <au>
                  <snm>Muriaux</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mirro</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Harvin</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Rein</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2001</pubdate>
            <volume>98</volume>
            <fpage>5246</fpage>
            <lpage>5251</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">33195</pubid>
                  <pubid idtype="pmpid" link="fulltext">11320254</pubid>
                  <pubid idtype="doi">10.1073/pnas.091000398</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Identification of tRNAs incorporated into wild-type and mutant human immunodeficiency virus type 1</p>
            </title>
            <aug>
               <au>
                  <snm>Jiang</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mak</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ladha</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rovinski</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kleiman</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1993</pubdate>
            <volume>67</volume>
            <fpage>3246</fpage>
            <lpage>53</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">237665</pubid>
                  <pubid idtype="pmpid" link="fulltext">8497049</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>An avian oncovirus mutant (SE 21Q1b) deficient in genomic RNA: biological and biochemical characterization</p>
            </title>
            <aug>
               <au>
                  <snm>Linial</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Medeiros</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Hayward</snm>
                  <fnm>WS</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1978</pubdate>
            <volume>15</volume>
            <fpage>1371</fpage>
            <lpage>1381</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(78)90062-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">83199</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Selective and Nonselective Packaging of Cellular RNAs in Retrovirus Particles</p>
            </title>
            <aug>
               <au>
                  <snm>Rulli</snm>
                  <fnm>SJ</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Hibbert</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Mirro</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Pederson</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Biswal</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rein</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2007</pubdate>
            <volume>81</volume>
            <fpage>6623</fpage>
            <lpage>6631</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1128/JVI.02833-06</pubid>
                  <pubid idtype="pmpid" link="fulltext">17392359</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>An avian oncovirus mutant deficient in genomic RNA: characterization of the packaged RNA as cellular messenger RNA</p>
            </title>
            <aug>
               <au>
                  <snm>Gallis</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Linial</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Eisenman</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1979</pubdate>
            <volume>94</volume>
            <fpage>146</fpage>
            <lpage>161</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(79)90445-8</pubid>
                  <pubid idtype="pmpid">220781</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Studies on the RNA from avian myeloblastosis virus</p>
            </title>
            <aug>
               <au>
                  <snm>Erikson</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1969</pubdate>
            <volume>37</volume>
            <fpage>124</fpage>
            <lpage>131</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(69)90313-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">4302800</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The low molecular weight RNAs of Rous sarcoma virus. II. The 7 S RNA</p>
            </title>
            <aug>
               <au>
                  <snm>Bishop</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Levinson</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Sullivan</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Fanshier</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Quintrell</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1970</pubdate>
            <volume>42</volume>
            <fpage>927</fpage>
            <lpage>937</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(70)90341-7</pubid>
                  <pubid idtype="pmpid">4321311</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Comparison of oligonucleotides produced by RNase T1 digestion of 7 S RNA from avian and murine oncornaviruses and from uninfected cells</p>
            </title>
            <aug>
               <au>
                  <snm>Erikson</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Erikson</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Henry</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Pace</snm>
                  <fnm>NR</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1973</pubdate>
            <volume>53</volume>
            <fpage>40</fpage>
            <lpage>46</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(73)90463-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">4350418</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Characterization of the low-molecular-weight RNAs associated with the 70S RNA of Rous sarcoma virus</p>
            </title>
            <aug>
               <au>
                  <snm>Faras</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Garapin</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Levinson</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Bishop</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Goodman</snm>
                  <fnm>HM</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1973</pubdate>
            <volume>12</volume>
            <fpage>334</fpage>
            <lpage>342</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">356628</pubid>
                  <pubid idtype="pmpid" link="fulltext">4355935</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Small RNAs of Rous sarcoma virus: characterization by two-dimensional polyacrylamide gel electrophoresis and fingerprint analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Sawyer</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Dahlberg</snm>
                  <fnm>JE</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1973</pubdate>
            <volume>12</volume>
            <fpage>1226</fpage>
            <lpage>1237</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">356763</pubid>
                  <pubid idtype="pmpid" link="fulltext">4357505</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>The 7S RNA common to oncornaviruses and normal cells is associated with polyribosomes</p>
            </title>
            <aug>
               <au>
                  <snm>Walker</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Pace</snm>
                  <fnm>NR</fnm>
               </au>
               <au>
                  <snm>Erikson</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Erikson</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Behr</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1974</pubdate>
            <volume>71</volume>
            <fpage>3390</fpage>
            <lpage>3394</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">433778</pubid>
                  <pubid idtype="pmpid">4530311</pubid>
                  <pubid idtype="doi">10.1073/pnas.71.9.3390</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Signal recognition particle contains a 7S RNA essential for protein translocation across the endoplasmic reticulum</p>
            </title>
            <aug>
               <au>
                  <snm>Walter</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Blobel</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1982</pubdate>
            <volume>299</volume>
            <fpage>691</fpage>
            <lpage>698</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/299691a0</pubid>
                  <pubid idtype="pmpid">6181418</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Packaging and reverse transcription of snRNAs by retroviruses may generate pseudogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Giles</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Caputi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Beemon</snm>
                  <fnm>KL</fnm>
               </au>
            </aug>
            <source>RNA</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <fpage>299</fpage>
            <lpage>307</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1370541</pubid>
                  <pubid idtype="pmpid" link="fulltext">14730028</pubid>
                  <pubid idtype="doi">10.1261/rna.2150604</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Retropseudogenes derived from the human Ro/SS-A autoantigen-associated hY RNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Perreault</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Noel</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Briere</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Cousineau</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Lucier</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Perreault</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Boire</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <fpage>2032</fpage>
            <lpage>2041</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1074747</pubid>
                  <pubid idtype="pmpid" link="fulltext">15817567</pubid>
                  <pubid idtype="doi">10.1093/nar/gki504</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>An association between globin messenger RNA and 60S RNA derived from Friend leukemia virus</p>
            </title>
            <aug>
               <au>
                  <snm>Ikawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ross</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Leder</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1974</pubdate>
            <volume>71</volume>
            <fpage>1154</fpage>
            <lpage>1158</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">388182</pubid>
                  <pubid idtype="pmpid">4524626</pubid>
                  <pubid idtype="doi">10.1073/pnas.71.4.1154</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>High-titer human immunodeficiency virus type 1-based vector systems for gene delivery into nondividing cells</p>
            </title>
            <aug>
               <au>
                  <snm>Mochizuki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Brady</snm>
                  <fnm>RO</fnm>
               </au>
               <au>
                  <snm>Reiser</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1998</pubdate>
            <volume>72</volume>
            <fpage>8873</fpage>
            <lpage>8883</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">110304</pubid>
                  <pubid idtype="pmpid" link="fulltext">9765432</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Zinc finger structures in the human immunodeficiency virus type 1 nucleocapsid protein facilitate efficient minus- and plus-strand transfer</p>
            </title>
            <aug>
               <au>
                  <snm>Guo</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kane</snm>
                  <fnm>BF</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gorelick</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Henderson</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Levin</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2000</pubdate>
            <volume>74</volume>
            <fpage>8980</fpage>
            <lpage>8988</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">102094</pubid>
                  <pubid idtype="pmpid" link="fulltext">10982342</pubid>
                  <pubid idtype="doi">10.1128/JVI.74.19.8980-8988.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>The signal recognition particle</p>
            </title>
            <aug>
               <au>
                  <snm>Keenan</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Freymann</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Stroud</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Walter</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Annu Rev Biochem</source>
            <pubdate>2001</pubdate>
            <volume>70</volume>
            <fpage>755</fpage>
            <lpage>775</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.biochem.70.1.755</pubid>
                  <pubid idtype="pmpid" link="fulltext">11395422</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Structural insights into the signal recognition particle</p>
            </title>
            <aug>
               <au>
                  <snm>Doudna</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Batey</snm>
                  <fnm>RT</fnm>
               </au>
            </aug>
            <source>Annu Rev Biochem</source>
            <pubdate>2004</pubdate>
            <volume>73</volume>
            <fpage>539</fpage>
            <lpage>557</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.biochem.73.011303.074048</pubid>
                  <pubid idtype="pmpid" link="fulltext">15189152</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Human APOBEC3 proteins, retrovirus restriction, and HIV drug resistance</p>
            </title>
            <aug>
               <au>
                  <snm>Hache</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Mansky</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Harris</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>AIDS Rev</source>
            <pubdate>2006</pubdate>
            <volume>8</volume>
            <fpage>148</fpage>
            <lpage>157</lpage>
            <xrefbib>
               <pubid idtype="pmpid">17078485</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>APOBEC3 Cytidine Deaminases: Distinct Antiviral Actions along the Retroviral Life Cycle</p>
            </title>
            <aug>
               <au>
                  <snm>Chiu</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Greene</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2006</pubdate>
            <volume>281</volume>
            <fpage>8309</fpage>
            <lpage>8312</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.R500021200</pubid>
                  <pubid idtype="pmpid" link="fulltext">16407183</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Cytoskeleton association and virion incorporation of the human immunodeficiency virus type 1 Vif protein</p>
            </title>
            <aug>
               <au>
                  <snm>Karczewski</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Strebel</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1996</pubdate>
            <volume>70</volume>
            <fpage>494</fpage>
            <lpage>507</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">189838</pubid>
                  <pubid idtype="pmpid" link="fulltext">8523563</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization or encapsidation</p>
            </title>
            <aug>
               <au>
                  <snm>Clever</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Parslow</snm>
                  <fnm>TG</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1997</pubdate>
            <volume>71</volume>
            <fpage>3407</fpage>
            <lpage>3414</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">191485</pubid>
                  <pubid idtype="pmpid" link="fulltext">9094610</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Monomeric APOBEC3G Is Catalytically Active and Has Antiviral Activity</p>
            </title>
            <aug>
               <au>
                  <snm>Opi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Takeuchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kao</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Khan</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Miyagi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Goila-Gaur</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Iwatani</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Levin</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Strebel</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2006</pubdate>
            <volume>80</volume>
            <fpage>4673</fpage>
            <lpage>4682</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1472092</pubid>
                  <pubid idtype="pmpid" link="fulltext">16641260</pubid>
                  <pubid idtype="doi">10.1128/JVI.80.10.4673-4682.2006</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages</p>
            </title>
            <aug>
               <au>
                  <snm>Romisch</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>FW</fnm>
               </au>
               <au>
                  <snm>Dobberstein</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>High</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Arthritis Res Ther</source>
            <pubdate>2006</pubdate>
            <volume>8</volume>
            <fpage>R39</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1526608</pubid>
                  <pubid idtype="pmpid" link="fulltext">16469117</pubid>
                  <pubid idtype="doi">10.1186/ar1895</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Expression of vascular endothelial growth factor D is associated with lymph node metastasis in human colorectal carcinoma</p>
            </title>
            <aug>
               <au>
                  <snm>Funaki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nishimura</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Harada</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ninomiya</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Terada</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Fushida</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tani</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fujimura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kayahara</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shimizu</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ohta</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Miwa</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Oncology</source>
            <pubdate>2003</pubdate>
            <volume>64</volume>
            <fpage>416</fpage>
            <lpage>422</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1159/000070301</pubid>
                  <pubid idtype="pmpid" link="fulltext">12759540</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

