It has been reported that APOBEC3A (A3A) does not have antiviral activity towards HIV-1 irrespective of the presence or absence of Vif 2021222527. To verify these results, we tested the antiviral activity of human A3A and its sensitivity to HIV-1 Vif by transient transfection of HeLa cells. We used two different vectors for the expression of HIV-1 Vif: pNLA-1 Vif, expressing Vif together with other viral proteins from a proviral backbone 36, and pcDNA-hVif, expressing codon-optimized Vif 37. Both forms of Vif can efficiently counteract the antiviral activity of A3G. HeLa cells were transfected with DNA encoding vif-defective HIV-1 and pcDNA-A3A together with either pNL-A1 (Fig. 1A, lanes 2 & 5) or pcDNA-hVif vector DNA (Fig. 1A, lanes 3 & 6) or empty vector (lanes 1 & 4). We found that neither expression of A1-Vif nor hVif reduced cellular A3A expression relative to the Vif-negative control (compare Fig. 1A, lanes 1–3). Furthermore, expression of Vif had no effect on the packaging of A3A into virus particles (Fig. 1A, compare lanes 4–6). We also compared the infectivity of viruses produced in the presence of A3A (Fig. 1B, lanes 2–4) to virus produced in the absence of A3A (Fig. 1B, lane 1) in a single cycle assay as described in Materials and Methods. Our data were consistent with previous reports and confirmed that A3A had no antiviral activity (Fig. 1B, compare lanes 1 & 2). Accordingly, the presence of Vif did not affect the infectivity of the viruses (Fig. 1B, lanes 3–4).

It is well documented that APOBEC3G (A3G) has antiviral activity and is sensitive to inhibition by HIV-1 Vif 345678910111213. Moreover, on comparing the amino acid sequences of A3G and A3A we found that A3A is highly homologous to the C-terminus of A3G (Fig. 2A). We therefore wanted to investigate whether the lack of A3A antiviral activity and the insensitivity of A3A to degradation by HIV-1 Vif were attributable to the lack of an N-terminal domain. We constructed an A3G-3A chimera by fusing the N-terminal domain of A3G to the N-terminus of A3A using a BamHI restriction site present in both A3G and A3A genes (Fig. 2A, BamHI). The resulting construct is schematically delineated in Fig. 2B. Expression of the A3G-3A chimera was analyzed by immunoblotting (Fig. 2C). For that purpose, HeLa cells were transfected with pcDNA-A3A (Fig. 2C, lane 1), pcDNA-A3G-3A (lane 2), or pcDNA-Apo3G (lane 3) and whole cells lysates were subjected to immunoblotting using an A3G-specific peptide antibody. Because of the high amino acid homology of A3A and A3G at their C-termini (Fig. 2A), the A3G antibody cross-reacted well with the A3A and A3G-3A proteins. A3A runs as a doublet on our gels. The reason for this is unclear but could be due to covalent post-translational modification of the protein or to initiation at an internal AUG codon.

First, we wanted to test whether the A3G-3A chimera displayed antiviral activity against HIV-1. We transfected HeLa cells with vif-defective HIV-1 DNA along with increasing amounts of pcDNA-A3G-3A (Fig. 3, lanes 1–3) or pcDNA-Apo3G DNA (Fig. 3, lanes 4–6). Cell lysates (Fig. 3A, cell) and concentrated cell-free virus preparations (Fig. 3A, virus) were prepared 24 h after transfection and analyzed by immunoblotting using an A3G-specific antibody (Fig. 3A, APO). The same blot was then re-probed with an HIV-positive human patient serum (Fig. 3A, CA). As can be seen, A3G-3A and A3G exhibited similar mobilities in the gel, were expressed at similar levels, and were packaged into virus particles with similar efficiency and in a dose-dependent manner.

The infectivity of the viruses produced in figure 3A was analyzed in a single-cycle infectivity assay as described in Materials and Methods. Virus produced in the absence of A3G was included as a control and its infectivity was defined as 100% (Fig. 3B, lane 7). The infectivity of the other viruses was normalized for equal input virus and was expressed as percentage of the A3G-negative virus (Fig. 3B, lanes 1–6). As expected, packaging of A3G resulted in the dose-dependent inhibition of viral infectivity (Fig. 3B, lanes 4–6). Interestingly, the infectivity of viruses containing increasing amounts of the A3G-3A chimera was also reduced in a dose-dependent manner (Fig. 3B, lanes 1–3). These results demonstrate that, unlike A3A, the A3G-3A chimera has antiviral activity.

HIV-1 Vif reduces cellular expression of A3G and inhibits packaging of A3G into virus particles. On the other hand, Vif neither affects the stability of A3A nor does it inhibit its encapsidation into HIV-1 virions (see Fig. 1A). We next investigated the sensitivity of A3G-3A to Vif-induced degradation and inhibition of virus-encapsidation. HeLa cells were transfected with vif-defective pNL4-3 DNA, along with pcDNA-A3G-3A (Fig. 4A, lanes 1–2 & 5–6) or pcDNA-Apo3G DNA (Fig. 4A, lanes 3–4 & 7–8) in the presence (odd lane numbers) or absence (even lane numbers) of pcDNA-hVif. Cell lysates and concentrated cell-free virus preparations were prepared 24 h after transfection and analyzed by immunoblotting using an A3G-specific antibody (Fig. 4A, APO). The same blot was then re-probed first with a monoclonal antibody to Vif (Fig. 4A, Vif) followed by an HIV-positive human serum (Fig. 4A, CA). We found that the A3G-3A chimera – like wt A3G – was sensitive to Vif-induced degradation (Fig. 4A, compare lanes 1–2 & 3–4). In addition, hVif inhibited the encapsidation of both wt A3G and the A3G-3A chimera (Fig. 4A, compare lanes 5–6 and 7–8). These results demonstrate that sensitivity to Vif is conferred to A3A by addition of the A3G N-terminal domain.

The infectivity of the viruses produced in figure 4A was analyzed in a single-cycle infectivity assay as described in Materials and Methods. The infectivity of virus produced in the absence of A3G and Vif (Fig. 4B, lane 1) was defined as 100% and used to calculate the relative infectivity of the remaining virus samples. Consistent with its effect on A3G and A3G-3A packaging, Vif efficiently inhibited the antiviral activities of A3G and A3G-3A (Fig. 4B compare lanes 1 to lanes 2 & 4). In contrast, the infectivity of viruses produced in the presence of A3G or A3G-3A but in the absence of Vif was significantly impaired (Fig. 4B, lanes 3 & 5). The less efficient inhibition of HIV-1 infectivity by A3G-3A when compared to A3G (Fig. 4B, lanes 3 versus 5) could be explained in part by the lower expression and encapsidation of A3G-3A relative to A3G in this experiment.

A3G is largely localized to the cytoplasm where it can be found diffusely distributed or enriched in P bodies or stress granules 9223839404142 A3A, on the other hand, has been identified in both the nucleus and cytoplasm of transiently transfected cells 212223. To determine the effects of the A3G N-terminal domain on the cellular distribution of A3A, a side-by-side comparison of the intracellular localization of A3G, A3A, and A3G-3A was performed. HeLa cells were transfected with vectors encoding untagged A3G, A3A, and A3G-3A proteins. Immediately after transfection, cells were detached from the monolayer and re-seeded into 12 well plates containing microscope cover slips. Cell were grown on the cover slips for 24 h; then, cells were fixed with ice-cold methanol (-20°C, 10 min) and stained with A3G-specific peptide antiserum (Fig. 5). Consistent with previous studies, A3G exhibited predominantly cytoplasmic fluorescence (Fig. 5A). As predicted, A3A revealed nuclear and cytoplasmic staining (Fig. 5B). Interestingly, the subcellular distribution of the A3G-3A chimera largely reflected that of A3G (Fig. 5C). Thus, addition of the N-terminal domain of A3G to A3A induced a redistribution of the protein to a largely cytoplasmic localization. Punctate structures were observed in all samples and presumably represent P bodies or stress granules.

We have previously established that A3G is packaged into virus particles as a stable complex with viral NPCs 35. We next wanted to test whether A3A and A3G-3A similarly assembled into viral NPCs. HeLa cells were transfected with DNA encoding vif-defective HIV-1 along with pcDNA-A3A (Fig. 6A), pcDNA-A3G (Fig. 6B), or pcDNA-A3G-3A DNA (Fig. 6C). Virus-containing supernatants were collected 48 h post transfection and concentrated by pelleting through 20% sucrose. Concentrated viruses were resuspended in 1 ml of DMEM and 50% each were loaded onto a 20–60% sucrose step gradient in the absence (Fig. 6, lanes 1–3) or presence of 0.1% Triton X-100 (Fig. 6, lanes 4–6). We have previously reported that components of the viral core, including nucleocapsid protein (NC), are resistant to 0.1% Triton X-100, whereas other viral components, such as matrix (MA) or envelope protein, are detergent sensitive and can be separated from core-associated proteins by sucrose step gradient centrifugation 43. In this assay, intact viruses accumulate at the 20%/60% interphase of the step gradient column as evidenced by the enrichment of NC and CA protein in the S3 fraction (Fig. 6, lane 3). As expected, A3A, A3G, and A3G-3A partitioned with the viral fractions in fraction S3. No viral proteins were identified in fractions S1 and S2 attesting to the absence of soluble secreted proteins in our virus preparations. Detergent treatment resulted in the partitioning of CA and NC between the soluble S1 fraction and the detergent resistant viral core fraction S3 (Fig. 6, lanes 4 & 6). Interestingly, detergent treatment resulted in the quantitative sequestration of A3A to the soluble S1 fraction (Fig. 6A, lane 4) suggesting that A3A was not associated with viral NCPs. In contrast, >70% of the virus-associated A3G copurified with viral NPCs in fraction S3 (Fig. 6B, lane 6). Interestingly, A3G-3A behaved very similar to A3G and exhibited significant resistance to detergent extraction (Fig. 6C, lane 6). Thus, the A3G N-terminal domain imposed A3G-like properties onto A3A not only with respect to intracellular localization but also as far as packaging into viral NPC and antiviral properties were concerned.

The vif-defective molecular clone pNL4-3Vif(-) 49 was used for the production of virus stocks. The construction of pcDNA-hVif for the expression of NL4-3 Vif from a codon-optimized gene under the transcriptional control of a CMV promoter has been described elsewhere 37. Construction of pcDNA-Apo3Gmyc for the expression of C-terminally epitope-tagged wild type (wt) human A3G was reported elsewhere 4. A variant, pcDNA-Apo3G, expressing untagged A3G was used for all of the experiments described in this study and was constructed by insertion of a stop codon at the end of the A3G gene in pcDNA-Apo3Gmyc 44. pBluescript-APO3A was generously provided by Peder Madsen 50 and was used as template for PCR amplification of A3A using the 5' primer ATCAAGAATTCGGGACAAGCACATGGAAG and the 3' primer TTGTATAAGCTTCAGTTTCCCTGATTCTGGAG. The resulting PCR product was cloned between the EcoRI and Hind III sites of pcDNA3.1(-). pcDNA-A3G-3A was constructed by cloning a BamHI and HindIII fragment from pcDNA-A3A into BamHI and HindIII digested pcDNA-Apo3G. This strategy resulted in the in-frame fusion of A3G residues 1–197 to residues 14 to 199 of A3A (see Fig. 2A).

HeLa cells were propagated in Dulbecco's modified Eagles medium (DMEM) containing 10% fetal bovine serum. LuSIV cells are derived from CEMx174 cells and contain a luciferase indicator gene under the control of the SIVmac239 LTR. These cells were obtained from Janice Clements through the NIH AIDS Research and Reference Reagent Program (Cat. no. 5460) and were maintained in complete RPMI 1640 medium supplemented with 10% FBS and hygromycin B (300 μg/ml). For transfection of HeLa cells, cells were grown in 25 cm² flasks to about 80% confluency. Cells were transfected using LipofectAMINE PLUS™ (Invitrogen Corp, Carlsbad CA) following the manufacturer's recommendations. A total of 5–6 μg of plasmid DNA per 25 cm² flask was generally used. Where appropriate, empty vector DNA (pcDNA3.1(-)MycHis (Invitrogen)) or vif-defective vector DNA (pNL-A1vif(-)) was used to adjust total DNA amounts. Cells were harvested 24 h post-transfection.

A peptide antibody to human A3G was prepared by immunizing rabbits with KLH-coupled peptides corresponding to residues 367 to 384 of human A3G. A goat anti-NC(p7) polyclonal antibody was a gift of Robert Gorelick. Viral matrix (MA) protein was identified by a mouse monoclonal anti-MA(p17) antibody (Cellular Products Inc. Buffalo NY). A monoclonal antibody to Vif (MAb #319) was used for all immunoblot analyses and was obtained from Michael Malim through the NIH AIDS Research and Reference Reagent Program. An HIV-positive patient serum was used for the identification of HIV-1 capsid (CA) protein.

For immunoblot analysis of intracellular proteins, whole cell lysates were prepared as follows: Cells were washed once with PBS, suspended in PBS and mixed with an equal volume of sample buffer (4% sodium dodecyl sulfate, 125 mM Tris-HCl, pH 6.8, 10% 2-mercaptoethanol, 10% glycerol, and 0.002% bromphenol blue). To analyze virus-associated proteins, cell-free filtered supernatants from transfected HeLa cells (5–6 ml) were pelleted (75 min, 35,000 rpm) through a 20% sucrose cushion (4 ml) in an SW41 rotor. The concentrated virus pellet was suspended in PBS and mixed with an equal volume of sample buffer. Proteins were solubilized by heating 10 to 15 min at 95°C. Cell and virus lysates were subjected to SDSPAGE; proteins were transferred to PVDF membranes and reacted with appropriate antibodies as described in the text. Membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies (Amersham Biosciences, Piscataway NJ) and proteins were visualized by enhanced chemiluminescence (ECL, Amersham Biosciences).

Virus stocks were prepared by transfection of HeLa cells with appropriate plasmid DNAs. Virus-containing supernatants were harvested 24 h after transfection. Cellular debris was removed by centrifugation (3 min, 1500 rpm) and clarified supernatants were filtered (0.45 μM) to remove residual cellular contaminations. Filtered virus stocks were further purified and concentrated by pelleting through 20% sucrose (75 min, 4°C at 35,000 rpm in an SW41 rotor).

To determine viral infectivity, virus stocks were normalized for equal reverse transcriptase activity and used to infect 5 × 10⁵ LuSIV cells 51 in a 24-well plate in a total volume of 1.2 to 1.4 ml. Infection was allowed for 24 h at 37°C. Cells were then harvested and lysed in 150 μl of Promega 1x reporter lysis buffer (Promega Corp., Madison WI). To determine the luciferase activity in the lysates, 50 μl of each lysate were combined with luciferase substrate (Promega Corp., Madison WI) by automatic injection and light emission was measured for 10 seconds at room temperature in a luminometer (Optocomp II, MGM Instruments, Hamden CT).

HeLa cells were transfected as indicated in the text. Transfected cells were trypsinized and single-cell suspensions were distributed into 12 well plates containing 0.13 mm cover slips. Cells were grown for 15 h at 37°C in DMEM containing 10% FBS. Cells were fixed at -20°C in precooled methanol (-20°C) for 10 minutes followed by two washes in PBS. For antibody staining, coverslips were incubated in a humid chamber at 37°C for 1 hr with primary antibodies at appropriate dilutions in 1% BSA in PBS. Coverslips were washed once in PBS (5 min, room temp) and incubated with Cy2-conjugated secondary antibodies (diluted in 1% BSA in PBS) for 30 min at 37°C in a humid chamber. Coverslips were then washed twice with PBS and mounted onto microscope slides with glycerol gelatin (Sigma-Aldrich Inc., St. Louis MO) containing 0.1 M N-propyl gallate (Sigma) to prevent photo bleaching. For confocal microscopy, a Zeiss LSM410 inverted laser scanning microscope equipped with a krypton/argon mixed-gas laser was employed. Images were acquired with a Plan-Apochromat 63x/1.4 oil immersion objective (Zeiss). Image quality was enhanced during data acquisition using the LSM line average feature (8x). Post-acquisition digital image enhancement was performed using the LSM software.

Sucrose step gradients were prepared as follows: 2.0 ml of a 60% sucrose solution (in PBS) was placed into the bottom of SW55 centrifuge tubes and overlaid with 2.1 ml of a 20% sucrose solution. Immediately prior to addition of concentrated virus stocks (500 μl), the step gradients were overlaid with 100 μl of either PBS or 1% Triton X-100. This procedure minimized the time of detergent exposure of the virus. Samples were then centrifuged in a SW55Ti rotor (Beckman) for 60 min at 35,000 rpm and 4°C. Three fractions (S1, S2, S3) of 1.1 ml each were collected from the top. Aliquots of each fraction of step gradients were subsequently processed for immunoblotting.