<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1742-4690-5-29</ui>
   <ji>1742-4690</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p><it>Porphyromonas gingivalis </it>induces CCR5-dependent transfer of infectious HIV-1 from oral keratinocytes to permissive cells</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Giacaman</snm>
               <mi>A</mi>
               <fnm>Rodrigo</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>giac0015@umn.edu</email>
            </au>
            <au id="A2">
               <snm>Asrani</snm>
               <mi>C</mi>
               <fnm>Anil</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>asran003@umn.edu</email>
            </au>
            <au id="A3">
               <snm>Gebhard</snm>
               <mi>H</mi>
               <fnm>Kristin</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>kristingebhard@mac.com</email>
            </au>
            <au id="A4">
               <snm>Dietrich</snm>
               <mi>A</mi>
               <fnm>Elizabeth</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>dietrice@gmail.com</email>
            </au>
            <au id="A5">
               <snm>Vacharaksa</snm>
               <fnm>Anjalee</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>tang0160@umn.edu</email>
            </au>
            <au id="A6">
               <snm>Ross</snm>
               <mi>F</mi>
               <fnm>Karen</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>rossx007@umn.edu</email>
            </au>
            <au id="A7" ca="yes">
               <snm>Herzberg</snm>
               <mi>C</mi>
               <fnm>Mark</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>mcherzb@umn.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Diagnostic and Biological Sciences, School of Dentistry, University of Minnesota, Minneapolis, MN 55455, USA</p>
            </ins>
            <ins id="I2">
               <p>The Mucosal and Vaccine Research Center, Minneapolis VA Medical Center, Minneapolis, MN 55417, USA</p>
            </ins>
            <ins id="I3">
               <p>Departamento de Rehabilitaci&#243;n Buco-Maxilofacial, University of Talca, Talca, Chile</p>
            </ins>
         </insg>
         <source>Retrovirology</source>
         <issn>1742-4690</issn>
         <pubdate>2008</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>29</fpage>
         <url>http://www.retrovirology.com/content/5/1/29</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18371227</pubid>
               <pubid idtype="doi">10.1186/1742-4690-5-29</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>18</day>
               <month>9</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>27</day>
               <month>3</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>27</day>
               <month>3</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Giacaman et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Systemic infection with HIV occurs infrequently through the oral route. The frequency of occurrence may be increased by concomitant bacterial infection of the oral tissues, since co-infection and inflammation of some cell types increases HIV-1 replication. A putative periodontal pathogen, <it>Porphyromonas gingivalis </it>selectively up-regulates expression of the HIV-1 coreceptor CCR5 on oral keratinocytes. We, therefore, hypothesized that <it>P. gingivalis </it>modulates the outcome of HIV infection in oral epithelial cells.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Oral and tonsil epithelial cells were pre-incubated with <it>P. gingivalis</it>, and inoculated with either an X4- or R5-type HIV-1. Between 6 and 48 hours post-inoculation, <it>P. gingivalis </it>selectively increased the infectivity of R5-tropic HIV-1 from oral and tonsil keratinocytes; infectivity of X4-tropic HIV-1 remained unchanged. Oral keratinocytes appeared to harbor infectious HIV-1, with no evidence of productive infection. HIV-1 was harbored at highest levels during the first 6 hours after HIV exposure and decreased to barely detectable levels at 48 hours. HIV did not appear to co-localize with <it>P. gingivalis</it>, which increased selective R5-tropic HIV-1 <it>trans </it>infection from keratinocytes to permissive cells. When CCR5 was selectively blocked, HIV-1 <it>trans </it>infection was reduced.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p><it>P. gingivalis </it>up-regulation of CCR5 increases <it>trans </it>infection of harbored R5-tropic HIV-1 from oral keratinocytes to permissive cells. Oral infections such as periodontitis may, therefore, increase risk for oral infection and dissemination of R5-tropic HIV-1.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Systemic infection after oral exposure to HIV-1 has been reported in breastfed infants from seropositive mothers <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Whether HIV/AIDS is acquired through oral exposure to seminal fluid from HIV-positive individuals remains equivocal <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Yet, experimental evidence points to the plausibility that exposure of the oral mucosal epithelium to HIV-1 results in primary infection of the oral tissues followed by systemic dissemination. For example, when simian immunodeficiency virus (SIV) is non-traumatically swabbed on the gingival and buccal mucosa of primates, oral epithelial infection is evident within one day <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>, while systemic infection occurs within a week <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Consistent with these observations, human oral epithelial cells of HIV-infected patients contain integrated HIV-1 DNA, which may result from either primary infection or systemic dissemination of the virus <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. HIV-1 has also been suggested to infect human oral epithelial cells in vitro <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. Recent work from our laboratory shows that replication aborts after viral integration, while harbored virions are transmissible from oral keratinocytes to permissive cells <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. In vivo, however, human oral epithelium is generally not considered a target for primary infection by HIV-1 <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>.</p>
         <p>Mucosal exposure is responsible for the vast majority of the current HIV infections worldwide <abbrgrp><abbr bid="B12">12</abbr></abbrgrp> and R5-tropic HIV-1 accounts for most of primary infections <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. In mucosal tissues such as in the gut, CCR5 has been proposed to act as a "gatekeeper", facilitating primary infection by R5-tropic while excluding X4-tropic HIV-1 <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. Indeed, primary R5-tropic HIV-1 infection generally requires target cells that carry a specific receptor for gp120 such as CD4 and the chemokine coreceptor CCR5 <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Interestingly, a homozygous defect in expression of the R5-tropic coreceptor CCR5 is associated with resistance to HIV-1 infection in frequently exposed individuals <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. On mucosal surfaces where epithelial cells predominate, the mechanism by which R5-tropic HIV-1 is specifically selected, and X4 HIV-1 is relatively excluded remains unclear. Many potential "gatekeeper" mechanisms have been proposed <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. More than relying on a single "gatekeeper", selective R5-HIV transmission seems to depend on the aggregate activity of cell and tissue specific restrictive barriers and facilitated uptake mechanisms encountered as HIV-1 passes from the mucosal surface to permissive cells in the organized lymphoid tissues <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>.</p>
         <p>Healthy squamous oral keratinocytes predominately express CXCR4 <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, but low to undetectable levels of CCR5 <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp> and there is no expression of the major HIV-1 receptor, CD4 <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B11">11</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr></abbrgrp>. Given that oral keratinocytes can integrate HIV-1 DNA, alternative HIV-1 receptors have been proposed, including galactosyl ceramide (GalCer) <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>, heparan sulfate proteoglycans <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B25">25</abbr></abbrgrp>, syndecans <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>, and mannose receptor <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. In concert with CXCR4 (X4-tropic HIV-1 specific) or CCR5 (R5-tropic HIV-1 specific) chemokine coreceptors, these alternative receptors have been suggested to take up infectious HIV-1 <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>, which can then be transferred to permissive cells <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>.</p>
         <p>Since oral epithelial cells express only CXCR4 <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B22">22</abbr></abbrgrp>, and oral keratinocytes in vitro can internalize and transfer infectious HIV-1 <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, we sought to learn if CCR5 coreceptor regulation by co-infecting oral bacteria could result in increased uptake and transfer of R5-tropic HIV-1. Co-infecting viruses, such as human herpesvirus 6 (HHV-6) and HHV-7, down-regulate expression of the HIV-1 co-receptor, CXCR4 <abbrgrp><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. Since HHV modulation does not affect CCR5, CXCR4 down-regulation may increase the relative expression of CCR5, enhancing the "gatekeeper". Our group has recently shown that <it>Porphyromonas gingivalis</it>, an endogenous periodontal pathogen, selectively up-regulates CCR5 in oral keratinocytes <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. These cells increase CCR5 expression when signaled through protease-activated receptors (PAR) and TLRs by the <it>P. gingivalis </it>putative virulence factors, gingipains (Rgp and Kgp) and LPS, respectively <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. We, therefore, hypothesized that <it>P. gingivalis </it>co-infection increases HIV-1 transfer of infectious R5-tropic HIV-1 from oral keratinocytes to permissive cells. In the absence of productive infection in oral keratinocytes, we showed that <it>P. gingivalis </it>caused a CCR5-dependent increase in transfer of R5-tropic HIV-1. As a consequence of primary non-productive infection, R5-tropic HIV-1 is suggested to disseminate selectively from oral mucosal epithelium in association with <it>P. gingivalis </it>infection in periodontitis.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p><it>P. gingivalis</it>-induced release of infectious R5-specific HIV-1 from oral epithelial cells</p>
            </st>
            <p>To learn whether <it>P. gingivalis </it>might increase release of infectious HIV-1, TERT-2 cells were pre-incubated with <it>P. gingivalis</it>, and then inoculated with R5- or X4-tropic HIV-1. Supernatants were collected and presented to reporter TZM-bl cells to assay for infectious HIV-1. From 7 to 54 h post-inoculation, TERT-2 cells pre-incubated with <it>P. gingivalis </it>released significantly more infectious R5-tropic HIV-1 into the supernatants than cells incubated with virus alone (Fig. <figr fid="F1">1A</figr>). Release of the X4-tropic strain was unaffected by <it>P. gingivalis </it>(Fig. <figr fid="F1">1B</figr>) and was slightly lower than R5-tropic HIV-1, particularly at 7 and 9 h post-inoculation. Like TERT-2 cells, tonsil epithelial cells released significantly more infectious R5-tropic HIV-1 when pre-incubated with <it>P. gingivalis </it>(Fig. <figr fid="F1">1C</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Assay of infectious HIV-1 virions released by oral epithelial cells</p>
               </caption>
               <text>
                  <p><b>Assay of infectious HIV-1 virions released by oral epithelial cells</b>. TERT-2 cells (A and B) and primary tonsil cells (C), with and without <it>P. gingivalis </it>pre-incubation, were incubated with (A and C) R5-HIV-1 (Ba-L) or (B) X4-HIV-1 (IIIb) as described in the Materials and Methods. In brief, cell monolayers were incubated with <it>P. gingivalis </it>for 3 h, washed, inoculated with HIV-1 and incubated for 3 h, washed and then incubation continued for the total elapsed time as shown. At the indicated times, culture supernatants were harvested from the infected TERT-2 or tonsil epithelial cells and incubated with TZM-bl reporter cells for 2 h. At 2 h, the TZM-bl medium was changed and incubation continued for 24 h. Cells were stained with X-Gal and infected reporter cells per well were counted. Data represent the mean number &#177; SEM of infected reporter TZM-bl cells per well at the times indicated from 4 independent experiments. * p-value &lt; 0.05, ** p-value &lt; 0.001.</p>
               </text>
               <graphic file="1742-4690-5-29-1"/>
            </fig>
            <p>Since the R5-tropic HIV-1-containing TERT-2 cell supernatants were more infectious when cells were pre-treated with <it>P. gingivalis</it>, we sought to learn whether TERT-2 cells released more HIV-1 p24. In the presence or absence of <it>P. gingivalis</it>, TERT-2 cells released similar amounts of p24 after inoculation with R5- (Fig. <figr fid="F2">2A</figr>) or X4-HIV-1 (Fig. <figr fid="F2">2B</figr>). From 7 to 18 h post-inoculation, X4- and R5-tropic HIV p24 released from TERT-2 cells increased and then remained constant until 54 h.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Total HIV-1 load associated with oral epithelial cells</p>
               </caption>
               <text>
                  <p><b>Total HIV-1 load associated with oral epithelial cells</b>. (A and B) TERT-2 cells were pre-incubated with and without <it>P. gingivalis </it>and then inoculated with R5- (A) and X4-HIV-1 (B). Harvested at the indicated times, supernatants were analyzed for HIV p24 by ELISA. The protocol is as described in the Materials and Methods and summarized in the legend of Fig. 1. Values are the mean of 3 independent experiments and are expressed as ng/mL of p24 &#177; SEM. (C and D) Expression of HIV<it>gag </it>in TERT-2 cells. TERT-2 and TZM-bl cells were pre-incubated with or without <it>P. gingivalis </it>and then inoculated with HIV-1 Ba-L (C) or IIIb (D). Total RNA was extracted from the cells, reverse transcribed and used as template in real-time PCR for HIV<it>gag </it>RNA. HIV<it>gag </it>RNA in TERT-2 cells was expressed relative to the expression in TZM-bl cells at 7 h after HIV inoculation. Beta actin was used as housekeeping gene. Data represent the mean of 3 independent experiments &#177; SEM.</p>
               </text>
               <graphic file="1742-4690-5-29-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Effect of <it>P. gingivalis </it>on TERT-2 cell-associated HIV-1</p>
            </st>
            <p>To determine if <it>P. gingivalis </it>increased viral association with TERT-2 cells, RNA from infected TERT-2 cells was recovered between 7 and 54 hours post-inoculation and HIV<it>gag </it>RNA was quantified by real-time PCR. In the presence and absence of <it>P. gingivalis</it>, greater levels of HIV<it>gag </it>RNA were generally recovered from R5- (Fig. <figr fid="F2">2C</figr>) than X4-HIV-1 (Fig. <figr fid="F2">2D</figr>) infected TERT-2 cells.</p>
         </sec>
         <sec>
            <st>
               <p><it>P. gingivalis </it>effects on HIV-1 replication</p>
            </st>
            <p>To determine if <it>P. gingivalis </it>affects HIV-1 replication in the oral keratinocytes, TERT-2 cells were pre-incubated with the bacterium and inoculated with either HIV-1 strain. RNA was extracted from the TERT-2 cells and singly spliced HIV-1<it>vpr </it>transcripts (newly synthesized mRNA) were quantified by real-time PCR. In the presence or absence of <it>P. gingivalis</it>, singly spliced Ba-L and IIIb transcripts were undetectable in the oral keratinocytes for up to 54 h post-inoculation (data not shown). When TZM-bl cells were inoculated directly, however, singly spliced Ba-L and IIIb transcripts increased about 100-fold between 7 and 54 h post-inoculation (Fig. <figr fid="F3">3</figr>). After inoculation with HIV-1 IIIB or Ba-L, TZM-bl cells, but not TERT-2 cells, contained p24gag as shown by immunoblotting (data not shown). These data suggest that there is no replicative cycle of HIV-1 in TERT-2 cells, even when cells are pre-incubated with <it>P. gingivalis</it>.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>HIV-1 replication undetectable in oral keratinocytes</p>
               </caption>
               <text>
                  <p><b>HIV-1 replication undetectable in oral keratinocytes</b>. TZM-bl cells and TERT-2 cells were pre-incubated with and without <it>P. gingivalis </it>and then inoculated with R5- or X4-HIV-1 strains, washed and incubation continued in fresh medium. The protocol is as described in the Materials and Methods and summarized in the legend of Fig. 1. At the indicated times, total RNA was extracted, reverse transcribed, and analyzed by real-time PCR for the singly spliced gene HIV-1<it>vpr</it>. For both cell lines, relative expression of HIV <it>vpr</it>-specific singly spliced mRNA (fold-change) is presented in comparison to the levels in TZM-bl cells at 7 h. Beta actin was used as housekeeping gene. Data represent the mean &#177; SEM of 3 independent experiments. Shown only are data points for TZM-bl cells + HIV-1 IIIb and BaL and TERT-2 cells + HIV-1 BaL. Note that <it>P. gingivalis </it>had no effect on the fold-change in HIV <it>vpr</it>-specific, singly spliced mRNA.</p>
               </text>
               <graphic file="1742-4690-5-29-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p><it>P. gingivalis </it>increases harbored infectious HIV-1 in TERT-2 cells</p>
            </st>
            <p>Since <it>P. gingivalis </it>pre-incubation caused a selective increase in release of infectious R5-HIV-1 from TERT-2 cells (Fig. <figr fid="F1">1A</figr>), we determined whether infectious virions were internalized or plasma membrane-associated. Oral keratinocytes were pre-incubated with <it>P. gingivalis </it>and inoculated with HIV-1 as previously. At times from 7 to 54 h post-inoculation, cultures were washed to remove loosely associated virus and adherent, plasma membrane-associated HIV was detached using trypsin for 5 min. To assess the infectious levels of the detached viral particles, the medium was recovered and the trypsin was inactivated. The infectivity of the recovered HIV-1 was assayed using the TZM-bl reporter cells. Based on the responses of TZM-bl reporter cells, more infectious plasma membrane-associated R5-tropic HIV-1 was detached from TERT-2 cells pre-incubated with <it>P. gingivalis </it>than in the absence at all times (Fig. <figr fid="F4">4A</figr>). In the presence and absence of <it>P. gingivalis</it>, similar amounts of infectious membrane-associated X4-tropic HIV-1 were detached from TERT-2 cells (Fig. <figr fid="F4">4B</figr>). After removing the plasma membrane-associated virions, cells were lysed to recover internalized HIV-1. Lysates were inoculated onto the reporter TZM-bl cells to assess the levels of infectious intracellular HIV-1 within the oral keratinocytes. Oral epithelial cells pre-incubated with <it>P. gingivalis </it>contained more infectious intracellular R5-tropic HIV-1 than <it>P. gingivalis</it>-untreated cells (Fig. <figr fid="F4">4C</figr>). X4-HIV-1 inoculated keratinocytes contained barely detectable levels of intracellular infectious virus, which was unaffected by <it>P. gingivalis </it>(Fig. <figr fid="F4">4D</figr>). Hence, <it>P. gingivalis </it>increases harbored membrane-associated and intracellular R5-tropic HIV-1.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p><it>P. gingivalis </it>increases infectious HIV-1 associated with oral keratinocyte plasma membrane and intracellular fractions</p>
               </caption>
               <text>
                  <p><b><it>P. gingivalis </it>increases infectious HIV-1 associated with oral keratinocyte plasma membrane and intracellular fractions</b>. TERT-2 cells with or without pre-incubation with <it>P. gingivalis </it>were inoculated with R5- (Ba-L) (A and C) or X4-tropic (IIIb) (B and D) HIV-1. The protocol is as described in the Materials and Methods and summarized in the legend of Fig. 1. After washing, cells were trypsinized to recover membrane-associated (A and B) and cell-associated, trypsin-resistant infectious HIV-1 (C and D). To assay for infectious HIV-1 virions, virus-containing fractions were incubated with TZM-bl cells, stained with X-Gal and positive blue cells counted as described in the Materials and Methods. Data represent the mean &#177; SEM of TZM-bl positive cells from two independent experiments, each in triplicate.</p>
               </text>
               <graphic file="1742-4690-5-29-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Increase in TERT-2 cell-associated infectious R5-tropic HIV-1 blocked by anti-CCR5 antibodies</p>
            </st>
            <p>To explain increased cell-associated, infectious R5-tropic HIV-1 fractions (plasma membrane and intracellular), we first considered the possibility that R5-tropic HIV-1 binds <it>P. gingivalis</it>, which subsequently invades the oral keratinocytes <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. TERT-2 cells were pre-incubated with <it>P. gingivalis</it>, inoculated with R5-HIV-1 and observed by confocal microscopy. <it>P. gingivalis </it>and HIV-1 were also co-incubated on glass slides without cells and then observed. <it>P. gingivalis </it>and viruses did not appear to co-localize when co-cultured in the absence (Fig. <figr fid="F5">5A</figr>) or presence (Fig. <figr fid="F5">5B</figr> and <figr fid="F5">5C</figr>) of oral keratinocytes. When pre-incubated with <it>P. gingivalis</it>, TERT-2 cells appeared to contain more intracellular HIV-1 (data not shown).</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Increase in TERT-2 cell-associated, infectious HIV-1 independent of direct interactions with <it>P. gingivalis </it>and blocked by anti-CCR5</p>
               </caption>
               <text>
                  <p><b>Increase in TERT-2 cell-associated, infectious HIV-1 independent of direct interactions with <it>P. gingivalis </it>and blocked by anti-CCR5</b>. (A) <it>P. gingivalis </it>was co-cultured with R5-HIV-1 on glass slides. (B and C) TERT-2 cells were pre-incubated with <it>P. gingivalis</it>, washed and inoculated with R5-HIV (Ba-L), washed, fixed and permeabilized for confocal microscopy analysis. Cells were stained with antibodies (1:100 dilutions) against <it>P. gingivalis </it>and HIV p24, or isotype control IgG. The confocal analysis was validated for assessment of intracellular HIV-1 using TZM-bl cells. Color key: Blue, DAPI; Red, Alexa 568; and Green, FITC conjugated IgG. Scale bars: 5 &#956;m (A), 10 &#956;m (B and C). Pictures are representative of 2 independent experiments and show one z-slice through the middle of the nucleus. (D), TERT-2 cells were pre-incubated with <it>P. gingivalis </it>or untreated and then incubated with anti-CCR5 antibody for 1 h. All TERT-2 cell cultures were then inoculated with R5-HIV-1. Culture supernatants (gray) and cell lysates (black) were collected at 18 hours post-inoculation with <it>P. gingivalis </it>as described in the legend of Fig. 1. Infectious virions were estimated using TZM-bl reporter cells. Data represent the mean &#177; SEM of 3 independent experiments, each performed in triplicate.</p>
               </text>
               <graphic file="1742-4690-5-29-5"/>
            </fig>
            <p>We next tested whether up-regulation of the CCR5 HIV-1 coreceptor on TERT-2 cells <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> by <it>P. gingivalis </it>could contribute to the infectivity of R5-tropic HIV-1. Oral keratinocytes were pre-incubated with <it>P. gingivalis</it>, then incubated with anti-CCR5 antibody, and inoculated with HIV Ba-L. At 18 h post-inoculation, spent culture supernatants and TERT-2 cell lysates were recovered and assayed for infectivity using TZM-bl reporter cells. Anti-CCR5 caused a dose-dependent reduction in infectious R5-tropic HIV-1 from both the culture supernatants and the intracellular compartment of TERT-2 cells (Fig. <figr fid="F5">5D</figr>). At the highest dose tested, anti-CCR5 blocked the increase in R5-tropic HIV-1 infectivity attributable to <it>P. gingivalis </it>(Fig. <figr fid="F5">5D</figr>).</p>
         </sec>
         <sec>
            <st>
               <p><it>P. gingivalis </it>increases cell-to-cell <it>trans </it>infection of intracellular infectious HIV-1 from oral keratinocytes</p>
            </st>
            <p>Since <it>P. gingivalis</it>-pre-incubated cells contained more intracellular infectious R5-HIV-1 than unexposed keratinocytes (Fig. <figr fid="F4">4C</figr>), we studied whether <it>P. gingivalis </it>increased HIV entry to the cells. TERT-2 cells were exposed to <it>P. gingivalis </it>and both strains of HIV-1 as described previously. Plasma membrane-associated HIV-1 was removed by trypsin and TERT-2 cells were lysed at various times. Consistent with the ELISA data from the culture supernatants (Fig. <figr fid="F2">2A</figr> and <figr fid="F2">2B</figr>), TERT-2 cells pre-incubated in the presence or absence of <it>P. gingivalis </it>contained similar intracellular p24<sup>gag </sup>after inoculation with either R5- (Fig. <figr fid="F6">6A</figr>) or X4-tropic HIV-1 (Fig. <figr fid="F6">6B</figr>). When comparing both viral strains, however, levels of p24<sup>gag </sup>were higher for R5- than X4-tropic HIV-1 (Fig. <figr fid="F6">6A, B</figr>), which was consistent with the data for cell-associated HIV<it>gag </it>RNA (Fig. <figr fid="F2">2C</figr> and <figr fid="F2">2D</figr>) and supernatant p24<sup>gag </sup>(Fig. <figr fid="F2">2A</figr> and <figr fid="F2">2B</figr>).</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>CCR5-dependent cell-to-cell transfer of infectious HIV-1</p>
               </caption>
               <text>
                  <p><b>CCR5-dependent cell-to-cell transfer of infectious HIV-1</b>. TERT-2 cells were pre-incubated with <it>P. gingivalis </it>or untreated and then inoculated with (A) R5- and (B) X4-HIV-1. The protocol is as described in the Materials and Methods and summarized in the legend of Fig. 1. Cells were trypsinized, washed, and lysed. The lysates were assayed for HIV p24 by ELISA. Similarly, TERT-2 cells were pre-incubated with <it>P. gingivalis </it>or untreated and then incubated with (C) a 1:10 dilution of 200 &#956;g/mL anti-CCR5 antibody or (D) with 30 ng/mL or 300 ng/mL of the CCR5 inhibitor RANTES, and R5-HIV-1 for 6 h (in the presence of the antibody or RANTES). At 18 h post-inoculation, oral keratinocytes were detached with trypsin, washed twice and seeded onto TZM-bl cells for co-culture. Data represent the mean &#177; SEM from 3 independent experiments, each performed in triplicate. * p-value &lt; 0.05, ** p-value &lt; 0.001. (E) Photomicrographs of X-gal stained cell co-cultures of TERT-2 cells pre-incubated with <it>P. gingivalis </it>and infected with Ba-L for 6 h (I, II and III) as described above. In the co-cultures with TZM-bl cells, arrows identify some proximal TERT-2 cells (panels II and III). Positive control Ba-L-inoculated TZM-bl cells co-cultured with TZM-bl cells are also shown (IV). In panel IV, the arrow shows a multinucleated TZM-bl cell.</p>
               </text>
               <graphic file="1742-4690-5-29-6"/>
            </fig>
            <p>We next sought to learn whether oral keratinocytes pre-incubated with <it>P. gingivalis </it>transferred more infectious intracellular R5-HIV to permissive cells in co-culture. After trypsinization and removal of extracellular virus, <it>P. gingivalis </it>pre-incubated TERT-2 cells were incubated with R5-HIV-1 or X4-HIV-1 for 6 h and cultured for 18 h post-inoculation. At 18 h, infected TERT-2 cells were harvested and co-cultured with TZM-bl reporter cells for an additional 24 h. TERT-2 cells <it>trans </it>infected TZM-bl cells with more infectious R5-tropic HIV-1 when pre-incubated in the presence of <it>P. gingivalis </it>than in the absence (Fig. <figr fid="F6">6C</figr>). In contrast, X4-HIV-1 <it>trans </it>infection from TERT-2 cells to TZM-bl cells was not affected by <it>P. gingivalis </it>and was lower than R5-HIV-1 (data not shown).</p>
            <p>To determine whether <it>trans </it>infection of intracellular R5-HIV-1 was CCR5-dependent, TERT-2 cells pre-incubated with <it>P. gingivalis </it>were incubated with anti-CCR5 antibody and then inoculated with R5- or X4-HIV-1. TERT-2 cells incubated with CCR5 antibody and R5- or X4-HIV-1, in the absence of <it>P. gingivalis </it>served as negative control. Blocking the TERT-2 cell CCR5 receptor with antibodies significantly reduced <it>trans </it>infection of R5-HIV-1 (p &lt; 0.001) (Fig. <figr fid="F6">6C</figr>) but not X4-HIV-1 (not shown) to TZM-bl cells. After pre-incubation with <it>P. gingivalis</it>, anti-CCR5 reduced <it>trans </it>infection of R5-tropic HIV-1 to levels similar to HIV-1 inoculated TERT-2 cells without <it>P. gingivalis</it>.</p>
            <p>To confirm the role of CCR5, TERT-2 cells with or without pre-incubation with <it>P. gingivalis </it>were incubated with the CCR5 ligand, RANTES, at 30 and 300 ng/mL or with 10 or 100 nM of TAK-779. TAK-779 selectively blocks HIV gp120 interaction with CCR5 <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. Consistent with the CCR5 antibody data, cells incubated with RANTES (Fig. <figr fid="F6">6D</figr>) or TAK-799 (data not shown) before inoculation with HIV-1 showed statistically significant (p &lt; 0.05) dose-dependent reductions in the increased transfer of R5-HIV-1 mediated by <it>P. gingivalis</it>. As expected, TERT-2 cells inoculated with X4 viruses in the presence or absence of <it>P. gingivalis </it>were not affected by RANTES or TAK-779 (data not shown). In the absence of HIV-1, TERT-2 cells incubated with either <it>P. gingivalis</it>, CCR5 antibody, RANTES or TAK-779, showed no false-positive transfer (staining by TZM-bl reporter) (data not shown).</p>
            <p>At harvest, co-cultured TERT-2 cells, which had been washed and trypsinized to remove extracellular and plasma membrane-associated HIV-1, appeared to <it>trans </it>infect the TZM-bl reporter cells (Fig. <figr fid="F6">6E</figr>). In some fields, blue TZM-bl cells and TERT-2 cells appeared to grow independently (Fig. <figr fid="F6">6E</figr>, panel I). More commonly, blue TZM-bl cells and TERT-2 cells grew in direct contact (panels II, III). In comparison to co-culture with HIV-1 infected TERT-2 cells, TZM-bl-to-TZM-bl <it>trans </it>infection of R5-tropic HIV-1 resulted in 100-fold more infected reporter cells (data not shown), increased multinuclear cells with syncytia formation, and more intense staining (Fig. <figr fid="F6">6E</figr>, panel IV). Although the contact status with TZM-bl cells at the time of <it>trans </it>infection was not established, the images suggest that TERT-2 cells <it>trans </it>infect either released virus or directly transferred internalized HIV-1 mediated by cell-to-cell contacts. <it>P. gingivalis</it>-mediated increased transfer of intracellular HIV-1 was unrelated to reverse transcription. Indeed, AZT (500 &#956;M) maintained continuously in TERT-2 cells cultures did not affect the increase in R5-tropic HIV-1 <it>trans </it>infection caused by <it>P. gingivalis </it>(data not shown).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Endogenous bacteria may modulate HIV-1 infection. For example, we have shown that the oral endogenous pathogen, <it>P. gingivalis</it>, can up-regulate CCR5 on oral keratinocytes <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. We next sought to learn whether CCR5 up-regulation by <it>P. gingivalis </it>could modulate dissemination of R5-tropic HIV-1 from oral keratinocytes. In this report, we show that <it>P. gingivalis </it>increases the transmissibility of infectious R5-tropic HIV-1 to proximal permissive cells in vitro without affecting the dissemination of X4-tropic HIV-1. To the best of our knowledge, this is the first report of interactions between septic oral epithelial cells and HIV-1.</p>
         <p>HIV-1 infection never occurs in a sterile environment and the septic mucosal environment may affect susceptibility to HIV-1 infection. The oral mucosa and virtually all mucosal epithelial tissues are colonized by polymicrobial biofilms that may modify the acquisition of HIV-1 infection. Co-infecting microorganisms that affect the clinical course of HIV-AIDS or mechanisms of infection include <it>Mycobacterium tuberculosis </it><abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, human hepatitis C virus <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, hepatitis B (HBV) <abbrgrp><abbr bid="B39">39</abbr></abbrgrp> herpes simplex virus-2 (HSV-2) <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>, <it>Neisseria gonorrhea </it><abbrgrp><abbr bid="B41">41</abbr></abbrgrp>, cytomegalovirus, Epstein-Barr virus, HHV-6, -7, and -8, and human papilloma virus <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. When HIV and <it>Leishmania </it>co-infect, the severity increases for both infections <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. Similarly, the malaria-causing protozoan <it>Plasmodium </it>is highly associated with the occurrence <abbrgrp><abbr bid="B44">44</abbr></abbrgrp> and severity of HIV infections <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. Co-infection with <it>Mycobacterium avium </it>may directly increase the severity of infection by increasing HIV-1 replication <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>.</p>
         <p><it>P. gingivalis </it>is a putative pathogen associated with periodontitis, a polymicrobial infection of the gingiva and tooth-supporting connective tissues, bone and ligament <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. When challenged with commensal and pathogenic bacteria, oral keratinocytes release cytokines and chemokines <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>, which may function as chemoattractants for CD4-positive T cells <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. Infiltrating CD4+ T cells can then co-localize with keratinocytes, facilitating docking and transfer of infectious virions <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. In the gingiva, immature dendritic (Langerhans) cells <abbrgrp><abbr bid="B50">50</abbr></abbrgrp> typically co-localize with keratinocytes and T cells <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. Indeed, we show that TERT-2 cells contact and apparently transfer virus to co-cultured CD4-positive TZM-bl cells (Fig. <figr fid="F6">6E</figr> panels II&#8211;III), whereas the virus does not appear to interact directly with <it>P. gingivalis </it>(Fig. <figr fid="F5">5</figr>). The data also show that virus released by TERT-2 cells can also be captured by TZM-bl cells (Fig. <figr fid="F6">6E</figr> panel I). TZM-bl cells were used to both assay infectivity of cell-free HIV-1 and serve as a permissive target for <it>trans </it>infection of HIV-1 from oral keratinocytes. The results in TZM-bl cells parallel data we have obtained using primary tonsil keratinocytes and several keratinocyte cell lines using peripheral blood mononuclear cells as permissive targets (Vacharaksa et al, unpublished data).</p>
         <p>In the presence of <it>P. gingivalis</it>, TERT-2 (Fig. <figr fid="F6">6C, D</figr>) and primary tonsil epithelial cells (data not shown) selectively increase <it>trans </it>infection of R5-tropic HIV-1 to TZM-bl cells. The selective increase in infectious R5-tropic HIV-1 on the plasma membranes and within TERT-2 cells (Fig. <figr fid="F4">4</figr>), and release into the extracellular environment (Fig. <figr fid="F1">1A</figr>) is independent of new viral replication (Fig. <figr fid="F3">3</figr>). TERT-2 cells appear to take up and contain the same amount of HIV-1 over time in the presence and absence of <it>P. gingivalis </it>based on HIV-1<it>gag </it>RNA and p24 levels (Fig. <figr fid="F2">2</figr>). The reason for this striking increase in infectivity is not clear. The amount of recovered virus protein or RNA can be discordant with levels of infectious virions <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B52">52</abbr></abbrgrp>. Furthermore, non-permissive HIV-1 infection of oral keratinocytes occurs at low frequency, and small differences in the presence and absence of <it>P. gingivalis </it>may challenge the sensitivity and discrimination of the detection assays. To estimate viral infectivity, we show that counting 10 to 40 positive cells of the 1 &#215; 10<sup>4 </sup>TZM-bl cells per well is reproducible and reliable. Infectivity apparently discriminates better than detection or quantification of viral protein. It is clear, however, that the ability of keratinocytes to bind and capture HIV-1, as estimated by HIV<it>gag </it>RNA and p24 levels, does not reflect the persistence and transfer of infectious virions to target cells.</p>
         <p>Two plausible mechanisms emerge to explain the <it>P. gingivalis</it>-mediated selective increase in infectious R5-tropic HIV-1. As a consequence of <it>P. gingivalis</it>, TERT-2 cells selectively harbor and protect infectious R5-tropic HIV-1, but not CXCR4-tropic virus. In addition, <it>trans </it>infection of R5-tropic HIV-1 to permissive TZM-bl cells also increases in a CCR5 up-regulation-dependent manner. Although both are dependent on pre-incubation with <it>P. gingivalis</it>, these mechanisms differ.</p>
         <p>In response to <it>P. gingivalis</it>, infectious virions were consistently recovered from TERT-2 cell culture medium (Fig. <figr fid="F1">1A</figr>), cell surface (Fig. <figr fid="F4">4A</figr>) and within the cell (Fig. <figr fid="F4">4C</figr>). AZT treatment did not affect viral infectivity suggesting that transfer of intracellular R5-HIV-1 from oral keratinocytes was independent of intracellular viral uncoating or reverse transcription. Harbored HIV-1 remains infectious for up to two days (Figs. <figr fid="F1">1A</figr>, <figr fid="F4">4A, C</figr>). Dendritic cells show similar capability. For example, attachment of HIV-1 to DC-SIGN preserves infectious virus up to 4 days <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. When compared to cells that do not express DC-SIGN, preservation of viral infectivity results in an increase in <it>trans </it>infection to CD4+ permissive cells <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. The <it>P. gingivalis</it>-mediated selective increase in cell-associated R5-tropic HIV-1 suggests a novel protective activity is expressed in oral epithelial cells. This protective activity for harbored HIV-1 may be independent of the expression of CCR5. Protective activity may function directly on R5-tropic virus or by inhibiting HIV-1 inactivation mechanisms. <it>P. gingivalis </it>alters the gene expression profile in TERT-2 cells through lipopolysaccharide activation of Toll-like receptors and protease activation of protease-activated receptors <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Therefore, modulation of innate immunity by <it>P. gingivalis </it>may enable keratinocytes to increase the infectivity of harbored R5-tropic HIV-1.</p>
         <p>Perhaps in concert with protection of harbored virus, we also showed that <it>P. gingivalis</it>-mediated upregulation of CCR5 in TERT-2 cells <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> increases the effectiveness of <it>trans </it>infection to permissive TZM-bl cells (CD4+ CXCR4+ CCR5+). In TERT-2 cells, CCR5 appears to function primarily in <it>trans</it>, increasing the delivery of R5-tropic HIV-1 to CD4+ permissive cells. The <it>trans </it>function appears to be analogous to DC-SIGN on dendritic cells, which enables <it>trans </it>infection to permissive cells <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. Clearly, CCR5 blockade with specific antibodies, RANTES or a receptor antagonist inhibits the <it>P. gingivalis</it>-mediated increase in selective R5-tropic HIV-1 <it>trans </it>infection (Figs. <figr fid="F5">5</figr>, <figr fid="F6">6</figr>). The CCR5-dependent increase in <it>trans </it>infection of R5-tropic HIV-1 could reflect TERT-2 cell uptake, release or cell-to-cell transfer of virus. That <it>P. gingivalis </it>does not affect levels or kinetics of intracellular HIV-1<it>gag </it>RNA (Fig. <figr fid="F2">2C, D</figr>) and p24 (Fig. <figr fid="F6">6A, B</figr>) argues against a significant role for CCR5 in selective R5-tropic HIV-1 uptake in these cells. While the data suggest strongly that CCR5 is necessary for the specific <it>trans </it>infection of R5-tropic HIV-1, it is likely that internalization of the virus within the keratinocyte is CCR5-independent. Consistent with our findings, blocking CCR5 antibodies reduced transcytosis of R5-specific HIV-1 through primary genital epithelial cells, resulting in attenuated infection of CD4+ cells <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Furthermore, up-regulation of CCR5 appears to be necessary, but may not be sufficient for <it>trans </it>infection. The net effect of the <it>P. gingivalis</it>-mediated up-regulation of CCR5 expression, however, appears to be an increase in the proportion of R5-tropic HIV-1 that successfully transits though the keratinocyte to <it>trans </it>infect permissive targets.</p>
         <p>Interestingly, <it>P. gingivalis </it>proteases, particularly RgpA, inhibit gp120-mediated HIV-1 fusion with the highly permissive MT4 T-cell line and facilitate proteolysis of the CD4 receptor <abbrgrp><abbr bid="B54">54</abbr></abbrgrp>. In the present study, the CD4-negative oral keratinocytes <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B11">11</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr></abbrgrp> show HIV internalization in the presence of <it>P. gingivalis </it>Rgp. Like dendritic cells (DCs) <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>, HIV-1 appears to enter CD4- cells by endocytosis, involving clathrin-coated vesicles <abbrgrp><abbr bid="B55">55</abbr><abbr bid="B56">56</abbr></abbrgrp> or macropinosomes <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. Like DCs <abbrgrp><abbr bid="B53">53</abbr><abbr bid="B58">58</abbr></abbrgrp>, infection of oral keratinocytes is non-productive (Vacharaksa et al, unpublished), but it remains to be learned whether, like DCs <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B59">59</abbr></abbrgrp>, keratinocytes use synapse formation to <it>trans </it>infect. Indeed, recent evidence suggests that HIV-1 enters oral keratinocytes by an endocytic pathway within minutes (Dietrich et al, unpublished) without apparent reliance on gp120 and CD4-mediated membrane fusion <abbrgrp><abbr bid="B56">56</abbr><abbr bid="B57">57</abbr></abbrgrp>. If <it>P. gingivalis </it>modifies interactions between receptors or co-receptors and HIV-1, candidate targets would be other than cell-fusion associated CD4, CXCR4 and CCR5. Clearly, the interactions between TERT-2 cells and <it>P. gingivalis </it>are complex and up-regulation of CCR5 provides only a partial explanation for the increase in trans infection of R5-tropic HIV-1. If these mechanisms simulate pathways in vivo, the oral keratinocyte would be placed in the circuit of transmission of HIV-1, capturing R5-tropic HIV-1 from the mucosal surface and transferring the infectious virus to permissive cells such as infiltrating CD4-positive T cells or specific intraepithelial dendritic cells (DCs). Since iDCs dock with CD4+ T cells, <it>P. gingivalis</it>-infected oral keratinocytes can contribute to the selective systemic dissemination of R5-tropic HIV-1.</p>
         <p>Collectively, these data suggest that select mucosal sites in the oral cavity such as the periodontal tissues, where organisms like <it>P. gingivalis </it>are often abundant in the complex microflora <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>, may contribute to the complex set of restrictions and enabling pathways that in aggregate serve as the mucosal gatekeeper system for primary R5-tropic HIV-1 clinical infection <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. A CCR5-dependent gatekeeper mechanism, or one that is regulated by an endogenous co-pathogen, <it>P. gingivalis</it>, has not been previously recognized in oral epithelia. Somewhat analogous to <it>P. gingivalis </it>in oral keratinocytes <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, the oral pathogen <it>Actinobacillus actinomycetemcomitans </it>increases expression of HIV-1 coreceptors in monocytes <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>. Under conditions of inflammation or infection, polarized human endometrial cells also increase release of infectious HIV-1 to the extracellular compartment <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. Furthermore, in periodontitis, the epithelial barrier is disrupted <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>, increasing the proximity of virus or virus-infected keratinocytes to target T-cells <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B62">62</abbr></abbrgrp>, release of pro-inflammatory cytokines <abbrgrp><abbr bid="B63">63</abbr></abbrgrp> and activation of TLR-dependent signaling pathways by bacteria <abbrgrp><abbr bid="B64">64</abbr></abbrgrp>. Inflammation in the gingiva and oral mucosa could enhance HIV-1 infection of the oral tissues. For example, certain bacterial pathogens <abbrgrp><abbr bid="B64">64</abbr></abbrgrp> and <it>E. coli </it>LPS <abbrgrp><abbr bid="B65">65</abbr></abbrgrp> increase HIV-1 promoter activity by signaling through TLR4. We find no evidence that <it>P. gingivalis </it>increase HIV-1 transcriptional activity in TERT-2 cells. In control experiments, we ruled out that <it>P. gingivalis </it>and its products in spent bacterial media could activate the LTR promoter in TZM-bl cells (data not shown). Since infectious HIV-1 can be harbored in oral keratinocytes, the squamous mucosal epithelium may also constitute a cryptic reservoir of infection in vivo, which is enhanced specifically for R5-tropic HIV-1 in the presence of <it>P. gingivalis</it>. Periodontal disease and other oral infections and inflammatory conditions may, therefore, affect the risk for systemic dissemination of HIV-1 from an oral focus. If this speculation is confirmed, novel therapeutic strategies could be developed to thwart HIV-1 at its point of entry.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Cells</p>
            </st>
            <p>Immortalized human oral keratinocytes OKF6/TERT-2 (TERT-2) <abbrgrp><abbr bid="B66">66</abbr></abbrgrp> were provided by James Rheinwald of Harvard Medical School and cultured essentially as described previously <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. In brief, cells were grown in 5% CO<sub>2 </sub>at 37&#176;C in keratinocyte serum-free (KSF-M; Gibco), supplemented with 0.3 mM CaCl<sub>2</sub>, 25 &#956;g/mL bovine pituitary extract and 0.2 ng/mL epidermal growth factor (TERT-2 medium). Culture media was changed every two days and cells were subcultured at 60 to 70% confluency (about 5 days). Using an IRB approved protocol, palatine tonsil tissues were obtained from routine tonsillectomies performed at the Hennepin County Medical Center, Minneapolis, MN. Primary tonsil epithelial cells were isolated and cultured using a protocol modified from Oda and Watson <abbrgrp><abbr bid="B67">67</abbr></abbrgrp> as described <abbrgrp><abbr bid="B67">67</abbr></abbrgrp>. In brief, tonsil cells were cultured and the medium was partially replaced (70%) every 2 days. Once the primary culture was established, cells were passaged after 4 days in culture at 70 to 80% confluence. Only cells growing in passage 3 or 4 were used for the experiments. Tonsil epithelial cells were at least 96% epithelial based on flow cytometric analysis using epithelial and fibroblast markers. To serve as a positive control and also as permissive targets for HIV-1 infection, TZM-bl cells (JC53) <abbrgrp><abbr bid="B68">68</abbr></abbrgrp> were obtained from and cultured as recommended by the NIH AIDS Research and Reference Reagent Program, MD.</p>
         </sec>
         <sec>
            <st>
               <p>Viruses and bacteria</p>
            </st>
            <p>The X4- (IIIb) (AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: HTLV-III<sub>B</sub>/H9 from Dr. Robert Gallo, Cat. 398)<abbrgrp><abbr bid="B69">69</abbr></abbrgrp> and R5-tropic HIV-1 (Ba-L) (AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: HIV-1<sub>Ba-L </sub>from Dr. Suzanne Gartner, Dr. Mikulas Popovic and Dr. Robert Gallo, Cat. 510)<abbrgrp><abbr bid="B70">70</abbr></abbrgrp> strains were propagated in peripheral blood mononuclear cells (PBMCs) using the protocols of the NIH AIDS Research and Reference Reagent Program. To estimate the amount of infectious virus, the 50% infection endpoint method (TCID<sub>50</sub>) of Reed-Muench was used <abbrgrp><abbr bid="B71">71</abbr><abbr bid="B72">72</abbr></abbrgrp>. TCID<sub>50 </sub>of virus stocks was determined in PHA-activated PBMCs. A multiplicity of HIV-1 infection (MOI) of 0.005 was used to infect the cells (TCID<sub>50 </sub>per cell).</p>
            <p><it>P. gingivalis</it>, strain ATCC 33277, was grown under anaerobic conditions in a Coy anaerobic chamber (85% N<sub>2</sub>, 5% CO<sub>2 </sub>and 10% H<sub>2</sub>) at 37&#176;C on Todd-Hewitt agar plates (Difco) supplemented with 5% (v/v) defibrinated sheep blood or in Todd-Hewitt broth supplemented with 5 &#956;g/mL hemin (Sigma) and 1 &#956;g/mL menadione (Sigma). Bacteria were grown in 5 mL of broth for approximately 72 h to an OD<sub>620 nm </sub>of 0.9 to 1.1 (early stationary phase) and counted for determination of the bacterial MOI by the spiral plate method <abbrgrp><abbr bid="B73">73</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Infections with <it>P. gingivalis </it>and HIV-1</p>
            </st>
            <p>To serve as targets of HIV-1 infection, TERT-2 or tonsil epithelial cells (1 &#215; 10<sup>5</sup>) were seeded in 24-well plates and grown overnight. Culture medium was removed, replaced with fresh pre-warmed medium and freshly harvested <it>P. gingivalis </it>were added at a MOI of 100 for 3 h at 37&#176;C in spent Todd-Hewitt broth to a final volume of 500 &#956;L. After <it>P. gingivalis </it>incubation, cells were washed 5 times with Dulbecco's Phosphate-Buffered Saline (DPBS) (Gibco). Negative control cells (unexposed to <it>P. gingivalis</it>) were incubated with anaerobic Todd-Hewitt broth, and grown under identical conditions. After removing the bacteria at 3 h, HIV-1 IIIb or Ba-L in 500 &#956;L of medium was inoculated at an MOI 0.005 onto keratinocyte cultures and incubated. At 6 h, cells were washed 5 times with DPBS to remove excess virus, fresh medium was added, and incubation continued for up to 54 h post-inoculation with <it>P. gingivalis </it>(48 h after washing to remove HIV-1). At each time point, three different samples were obtained: (i) released HIV-1 in 500 &#956;L of spent cell culture supernatants; (ii) plasma membrane-associated HIV-1, and (iii) intracellular, trypsin-resistant HIV-1. To recover plasma membrane-associated virus (sample ii), cells were treated with 250 &#956;L of 0.05% trypsin-EDTA (Gibco) for 5 min at 37&#176;C. Trypsin was inactivated by addition of equal volumes of DMEM (Mediatech) supplemented with 10% FBS (TZM-bl medium). Cell suspensions were collected, centrifuged at 5,255 &#215; g for 1 min and supernatants were recovered containing membrane-associated HIV that was released by trypsin. The resulting cell pellet containing intracellular HIV-1 (sample iii) was resuspended in 500 &#956;L of TZM-bl medium, lysed by 3 cycles of freezing under liquid N<sub>2 </sub>and thawing at room temperature. Lysis was verified by light microscopy. The three samples were stored at -20&#176;C for infectious virion assay (see below) or p24 ELISA. HIV p24 in cell samples was estimated by ELISA (Beckman-Coulter) as described by the manufacturer.</p>
         </sec>
         <sec>
            <st>
               <p>TZM-bl reporter assay for infectious HIV</p>
            </st>
            <p>To determine transfer of infectious HIV-1 from oral keratinocytes, TZM-bl cells were seeded at 1 &#215; 10<sup>4 </sup>cells per well and grown overnight in 96-well plates. The HIV-1 samples (100 &#956;L of a 1:2 dilution) were incubated with TZM-bl reporter cells for 2 h at 37&#176;C in 5% CO<sub>2</sub>, washed 3 times with TZM-bl medium, and incubated for 24 h. TZM-bl cells were then fixed with 100 &#956;L of 0.05% glutaraldehyde for 5 min, and washed 3 times with DPBS. Cells were then covered with 50 &#956;L of X-Gal solution (500 mM potassium ferrocyanide, 500 mM potassium ferricyanide, 0.1 M magnesium chloride and 20 mg/mL X-Gal; all from Sigma) and incubated for 2 h at 37&#176;C in 5% CO<sub>2</sub>. After staining, blue positive cells were counted in each well under a light microscope. To assess specificity of the reporter cell to HIV infection, monolayers of TZM-bl cells were exposed to <it>P. gingivalis</it>-exposed and unexposed TERT-2 or TZM-bl supernatants without HIV-1 (negative control). At most, 1 or 2 blue-stained cells per well were detected as a false positive result.</p>
         </sec>
         <sec>
            <st>
               <p>Co-culture of infected TERT-2 cells with reporter TZM-bl cells</p>
            </st>
            <p>TERT-2 cells were pre-incubated with <it>P. gingivalis </it>for 3 h, washed 5 times, incubated with R5-HIV-1 (Ba-L) for 6 h, washed 5 times and incubated in TERT medium for 18 h post-inoculation. Extracellular HIV-1 was then removed by trypsin, cells were washed twice with TZM-bl medium and resuspended in TERT medium. TERT-2 cells (1 &#215; 10<sup>4</sup>) in suspension were added to monolayers of TZM-bl reporter cells per well in a mixture of equal volumes of TERT and TZM-bl media. Co-cultures were maintained for 24 h at 37&#176;C in 5% CO<sub>2 </sub>and stained with X-Gal solution, as above.</p>
         </sec>
         <sec>
            <st>
               <p>Quantitative PCR</p>
            </st>
            <p>Total RNA was extracted from oral keratinocytes with an AllPrep RNA/DNA Kit (Qiagen) according to the manufacturer's instructions and quantitated using the 2100 Bioanalizer (Agilent Technologies). Total RNA (500 ng) was used as template to make cDNA using the Superscript III First Strand Synthesis System for RT-PCR (Invitrogen). The cDNA was then diluted 1:5 with RNase/DNase free water and 1 &#956;l (5 ng) was used as template in the Platinum SYBR Green qPCR SuperMix-UDG w/ROX (Invitrogen). Quantitative PCR was performed on each sample in triplicate on an ABI7900 HT (Applied Biosystems) and subsequent analysis of the data was obtained using SDS 2.1 software (Applied Biosystems), normalizing all genes to human beta-actin (SuperArray Bioscience), employing the delta-delta CT method of relative quantitation <abbrgrp><abbr bid="B74">74</abbr></abbrgrp>. To characterize the HIV-1 life cycle, singly spliced HIV-1<it>vpr </it>transcripts and HIV<it>gag </it>RNA primers were used as shown in Table <tblr tid="T1">1</tblr> and also <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primer sequences and PCR conditions</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Target</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Primer</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sequences (5'-3')</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>PCR conditions</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gag</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>For</p>
                     </c>
                     <c ca="left">
                        <p>CCCATAGTGCAGAACATCCA</p>
                     </c>
                     <c ca="left">
                        <p>50&#176;C, 2 min, 95&#176;C, 2 min, and 95&#176;C, 15 s and 60&#176;C, 30 s, for 50 cycles</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Rev</p>
                     </c>
                     <c ca="left">
                        <p>GGGCTGAAAGCCTTCTCTTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Singly spliced</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>M669</p>
                     </c>
                     <c ca="left">
                        <p>GTGTGCCCGTCTGTTGTGTGACTCTGGTAAC</p>
                     </c>
                     <c ca="left">
                        <p>50&#176;C, 2 min, 95&#176;C, 2 min, and 95&#176;C, 15 s and 60&#176;C, 30 s, for 50 cycles</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>La 23</p>
                     </c>
                     <c ca="left">
                        <p>GCCTATTCTGCTATGTCGACACC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&#946; <b>-actin</b></p>
                     </c>
                     <c ca="left">
                        <p>Actin F</p>
                     </c>
                     <c ca="left">
                        <p>ATGGCCACGGCTGCTTCCAGC</p>
                     </c>
                     <c ca="left">
                        <p>95&#176;C, 15 s, 55&#176;C, 30 s, 72&#176;C, 15 s for 30 cycles</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Actin R</p>
                     </c>
                     <c ca="left">
                        <p>CATGGTGGTGCCGCCAGACAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>GAPDH</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GAPDH F</p>
                     </c>
                     <c ca="left">
                        <p>GAGTCAACGGATTTGGTCGT</p>
                     </c>
                     <c ca="left">
                        <p>95&#176;C, 15 s, 60&#176;C, 30 s, 72&#176;C, 15 s for 30 cycles</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GAPDH R</p>
                     </c>
                     <c ca="left">
                        <p>TTGATTTTGGAGGGATCTCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Confocal microscopy</p>
            </st>
            <p>TERT-2 cells (2 &#215; 10<sup>5</sup>) were seeded on cover slips in 12-well plates and cultured overnight at 37&#176;C in 5% CO<sub>2</sub>. Cells were incubated for 3 h with <it>P. gingivalis </it>ATCC 33277 at MOI 100, washed 5 times with DPBS, inoculated with HIV Ba-L for 2 h at MOI 0.005 and washed 5 more times. TERT-2 cells were prepared for microscopic observation, as described <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. For some experiments, <it>P. gingivalis </it>and HIV Ba-L were co-cultured on glass slides without cells. Cells were incubated with a 1:100 dilution (v/v) of murine anti-HIV p24 IgG1 monoclonal antibody (Chemicon Int., Millipore), murine IgG1 isotype control antibody (BD Biosciences, Pharmingen), or rabbit polyclonal anti-<it>P. gingivalis </it>IgG. After antibody incubation, cells were washed 5 times and incubated with ALEXA 568-conjugated donkey anti-murine IgG antibody (Molecular Probes) diluted 1:2000 (v/v) and/or FITC-conjugated goat anti-rabbit IgG antibody (Sigma) (1:1000 (v/v) dilution) and DAPI (Molecular Probes) at a 1:3000 (v/v) dilution for 1 h. Samples were observed using a confocal microscope (Olympus FluoView 1000). From each field, 10 to 30 consecutive sections of 0.5 &#956;m thickness were resolved at 1024 &#215; 1024 pixels, analyzed and pseudo-colored. Co-localization of antigens was determined in single sections from the image stacks. Final images were generated using ImageJ 1.37V software (National Institutes of Health). Microscope settings were kept identical for all images captured.</p>
         </sec>
         <sec>
            <st>
               <p>CCR5 blocking experiments</p>
            </st>
            <p>CCR5 was blocked on TERT-2 cells using goat anti-human CCR5 polyclonal antibody (CKR-5; Santa Cruz), recombinant human RANTES (CCL5) (Peprotech) or TAK-779 (NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH:TAK-779) <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> essentially as reported previously <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. In the presence of anti-human CCR5 or RANTES, TERT-2 cells were pre-incubated in the presence or absence of <it>P. gingivalis</it>. Cells were then inoculated with HIV-1 Ba-L or IIIb at a MOI 0.005, incubated for 6 h, washed 5 times with DPBS and cultured for 18 h post-inoculation. Culture supernatants or cell lysates were recovered, stored at -20&#176;C and inoculated onto TZM-bl cells to report infectious HIV. In some experiments, TERT-2 cells were trypsinized at 18 h post-inoculation and co-cultured with TZM-bl cells, as described above. Infectious virus from the samples was assayed in TZM-bl cells as described above. Oral keratinocytes in the presence or absence of <it>P. gingivalis </it>were used as positive and negative controls, respectively.</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analyses</p>
            </st>
            <p>Statistical analyses were performed by the Student's <it>t </it>test for paired values using GraphPad software. Differences were considered significant at a <it>p </it>&lt; 0.05.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>RAG conceived the study and designed the experiments, carried out most of the experimental work and drafted the manuscript. ACA performed all the real-time PCR reactions, contributed in the design of the experiments and actively participated in discussions about the study. KHG and EAD helped in the development of the infectivity assays, contributed editorial suggestions to the final versions of the manuscript and participated in helpful discussions. AV developed some of the protocols for the viral infections and the culture of the cells used in this study. KFR helped in the editing of the final versions of the manuscript and contributed to the analysis of the data. MCH advised about the study and its design, critically revised the manuscript, suggested significant modifications to its content and gave final approval to the submitted version.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>These studies were supported by NIH grants-in-aid DE015503 (to MCH), DE15506 (KFR), the Veterans Affairs Research Service, and the Mucosal and Vaccine Research Center. The expert technical support and advice of Claudine Fasching is greatly appreciated. This manuscript was submitted in partial fulfillment of the requirements for the PhD degree by RAG.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Mother-to-child transmission of HIV-1 infection during exclusive breastfeeding in the first 6 months of life: an intervention cohort study</p>
            </title>
            <aug>
               <au>
                  <snm>Coovadia</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Rollins</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Bland</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Little</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Coutsoudis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bennish</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Newell</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>2007</pubdate>
            <volume>369</volume>
            <issue>9567</issue>
            <fpage>1107</fpage>
            <lpage>1116</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(07)60283-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">17398310</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Oral HIV transmission</p>
            </title>
            <aug>
               <au>
                  <snm>Younai</snm>
                  <fnm>FS</fnm>
               </au>
            </aug>
            <source>J Calif Dent Assoc</source>
            <pubdate>2001</pubdate>
            <volume>29</volume>
            <issue>2</issue>
            <fpage>142</fpage>
            <lpage>148</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11324114</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Rapid dissemination of SIV following oral inoculation</p>
            </title>
            <aug>
               <au>
                  <snm>Milush</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Kosub</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Marthas</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Wozniakowski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Westmoreland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sodora</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>Aids</source>
            <pubdate>2004</pubdate>
            <volume>18</volume>
            <issue>18</issue>
            <fpage>2371</fpage>
            <lpage>2380</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15622313</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Mucosal innate immune response associated with a timely humoral immune response and slower disease progression after oral transmission of simian immunodeficiency virus to rhesus macaques</p>
            </title>
            <aug>
               <au>
                  <snm>Milush</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Stefano-Cole</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Durudas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pandrea</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Sodora</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2007</pubdate>
            <volume>81</volume>
            <issue>12</issue>
            <fpage>6175</fpage>
            <lpage>6186</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1900075</pubid>
                  <pubid idtype="pmpid" link="fulltext">17428863</pubid>
                  <pubid idtype="doi">10.1128/JVI.00042-07</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Rapid virus dissemination in infant macaques after oral simian immunodeficiency virus exposure in the presence of local innate immune responses</p>
            </title>
            <aug>
               <au>
                  <snm>Abel</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pahar</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Van Rompay</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Fritts</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Colon</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>McChesney</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marthas</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2006</pubdate>
            <volume>80</volume>
            <issue>13</issue>
            <fpage>6357</fpage>
            <lpage>6367</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1488945</pubid>
                  <pubid idtype="pmpid" link="fulltext">16775324</pubid>
                  <pubid idtype="doi">10.1128/JVI.02240-05</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Detection of human immunodeficiency virus type 1 RNA by in situ hybridization in oral mucosa epithelial cells from anti-HIV-1 positive patients</p>
            </title>
            <aug>
               <au>
                  <snm>Rodriguez-Inigo</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Jimenez</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bartolome</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ortiz-Movilla</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Bartolome Villar</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Jose Arrieta</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Manzarbeitia</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Carreno</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>J Med Virol</source>
            <pubdate>2005</pubdate>
            <volume>77</volume>
            <issue>1</issue>
            <fpage>17</fpage>
            <lpage>22</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/jmv.20409</pubid>
                  <pubid idtype="pmpid" link="fulltext">16032727</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Human immunodeficiency virus type 1 infection and replication in normal human oral keratinocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Zha</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nishitani</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Camargo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cole</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Zack</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2003</pubdate>
            <volume>77</volume>
            <issue>6</issue>
            <fpage>3470</fpage>
            <lpage>3476</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">149546</pubid>
                  <pubid idtype="pmpid" link="fulltext">12610122</pubid>
                  <pubid idtype="doi">10.1128/JVI.77.6.3470-3476.2003</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Oral epithelial cells are susceptible to cell-free and cell-associated HIV-1 infection in vitro</p>
            </title>
            <aug>
               <au>
                  <snm>Moore</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Rahemtulla</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Kent</snm>
                  <fnm>LW</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Ikizler</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>PF</fnm>
               </au>
               <au>
                  <snm>Nguyen</snm>
                  <fnm>HH</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2003</pubdate>
            <volume>313</volume>
            <issue>2</issue>
            <fpage>343</fpage>
            <lpage>353</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0042-6822(03)00283-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">12954203</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Paxton</snm>
                  <fnm>WA</fnm>
               </au>
               <au>
                  <snm>Choe</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ceradini</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Horuk</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>MacDonald</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Stuhlmann</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Koup</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Landau</snm>
                  <fnm>NR</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1996</pubdate>
            <volume>86</volume>
            <issue>3</issue>
            <fpage>367</fpage>
            <lpage>377</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)80110-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">8756719</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Oral mucosal immunity and HIV/SIV infection</p>
            </title>
            <aug>
               <au>
                  <snm>Lu</snm>
                  <fnm>FX</fnm>
               </au>
               <au>
                  <snm>Jacobson</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>J Dent Res</source>
            <pubdate>2007</pubdate>
            <volume>86</volume>
            <issue>3</issue>
            <fpage>216</fpage>
            <lpage>226</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17314252</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Expression of HIV receptors, alternate receptors and co-receptors on tonsillar epithelium: implications for HIV binding and primary oral infection</p>
            </title>
            <aug>
               <au>
                  <snm>Kumar</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Maher</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Herzberg</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Southern</snm>
                  <fnm>PJ</fnm>
               </au>
            </aug>
            <source>Virol J</source>
            <pubdate>2006</pubdate>
            <volume>3</volume>
            <fpage>25</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1459853</pubid>
                  <pubid idtype="pmpid" link="fulltext">16600047</pubid>
                  <pubid idtype="doi">10.1186/1743-422X-3-25</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Mucosal transmission of HIV-1: first stop dendritic cells</p>
            </title>
            <aug>
               <au>
                  <snm>Wilkinson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cunningham</snm>
                  <fnm>AL</fnm>
               </au>
            </aug>
            <source>Curr Drug Targets</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <issue>12</issue>
            <fpage>1563</fpage>
            <lpage>1569</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2174/138945006779025482</pubid>
                  <pubid idtype="pmpid" link="fulltext">17168831</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Primary intestinal epithelial cells selectively transfer R5 HIV-1 to CCR5+ cells</p>
            </title>
            <aug>
               <au>
                  <snm>Meng</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Wei</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Sellers</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Decker</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Moldoveanu</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Orenstein</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Kappes</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Mestecky</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Shaw</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>2002</pubdate>
            <volume>8</volume>
            <issue>2</issue>
            <fpage>150</fpage>
            <lpage>156</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm0202-150</pubid>
                  <pubid idtype="pmpid" link="fulltext">11821899</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>The CCR5 and CXCR4 coreceptors--central to understanding the transmission and pathogenesis of human immunodeficiency virus type 1 infection</p>
            </title>
            <aug>
               <au>
                  <snm>Moore</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Kitchen</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Pugach</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zack</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>AIDS Res Hum Retroviruses</source>
            <pubdate>2004</pubdate>
            <volume>20</volume>
            <issue>1</issue>
            <fpage>111</fpage>
            <lpage>126</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/088922204322749567</pubid>
                  <pubid idtype="pmpid" link="fulltext">15000703</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>CD4 T cell surface CCR5 density as a host factor in HIV-1 disease progression</p>
            </title>
            <aug>
               <au>
                  <snm>Reynes</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Portales</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Segondy</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Baillat</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Andre</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Avinens</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Picot</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Clot</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Eliaou</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Corbeau</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Aids</source>
            <pubdate>2001</pubdate>
            <volume>15</volume>
            <issue>13</issue>
            <fpage>1627</fpage>
            <lpage>1634</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00002030-200109070-00004</pubid>
                  <pubid idtype="pmpid" link="fulltext">11546936</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Mucosal gatekeepers: selecting HIV viruses for early infection</p>
            </title>
            <aug>
               <au>
                  <snm>Bomsel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>David</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>2002</pubdate>
            <volume>8</volume>
            <issue>2</issue>
            <fpage>114</fpage>
            <lpage>116</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm0202-114</pubid>
                  <pubid idtype="pmpid" link="fulltext">11821891</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Selective transmission of CCR5-utilizing HIV-1: the 'gatekeeper' problem resolved?</p>
            </title>
            <aug>
               <au>
                  <snm>Margolis</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Shattock</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nat Rev Microbiol</source>
            <pubdate>2006</pubdate>
            <volume>4</volume>
            <issue>4</issue>
            <fpage>312</fpage>
            <lpage>317</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16541138</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>CD4-Induced conformational changes in the human immunodeficiency virus type 1 gp120 glycoprotein: consequences for virus entry and neutralization</p>
            </title>
            <aug>
               <au>
                  <snm>Sullivan</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sattentau</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Thali</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Denisova</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Gershoni</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Robinson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sodroski</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1998</pubdate>
            <volume>72</volume>
            <issue>6</issue>
            <fpage>4694</fpage>
            <lpage>4703</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">109994</pubid>
                  <pubid idtype="pmpid" link="fulltext">9573233</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Oral mucosal expression of HIV-1 receptors, co-receptors, and alpha-defensins: tableau of resistance or susceptibility to HIV infection?</p>
            </title>
            <aug>
               <au>
                  <snm>Cutler</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Jotwani</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Adv Dent Res</source>
            <pubdate>2006</pubdate>
            <volume>19</volume>
            <issue>1</issue>
            <fpage>49</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16672549</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Porphyromonas gingivalis Selectively Up-Regulates the HIV-1 Coreceptor CCR5 in Oral Keratinocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Giacaman</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Nobbs</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Ross</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Herzberg</snm>
                  <fnm>MC</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2007</pubdate>
            <volume>179</volume>
            <issue>4</issue>
            <fpage>2542</fpage>
            <lpage>2550</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17675516</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Human epithelial beta-defensins 2 and 3 inhibit HIV-1 replication</p>
            </title>
            <aug>
               <au>
                  <snm>Quinones-Mateu</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Lederman</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Chakraborty</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Weber</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rangel</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Marotta</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Mirza</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jiang</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kiser</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Medvik</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sieg</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Weinberg</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Aids</source>
            <pubdate>2003</pubdate>
            <volume>17</volume>
            <issue>16</issue>
            <fpage>F39</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00002030-200311070-00001</pubid>
                  <pubid idtype="pmpid" link="fulltext">14571200</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Infection and Replication of HIV-1 in Immortalized Oral Keratinocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Vacharaksa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Asrani</snm>
                  <mi>C</mi>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gebhard</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Faschling</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Janoff </snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ross</snm>
                  <mi>F</mi>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Herzberg</snm>
                  <mi>C</mi>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Submitted</source>
            <pubdate>2007</pubdate>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Epithelial uptake and transport of cell-free human immunodeficiency virus type 1 and gp120-coated microparticles</p>
            </title>
            <aug>
               <au>
                  <snm>Kage</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Shoolian</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Rokos</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ozel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nuck</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Reutter</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Kottgen</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Pauli</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1998</pubdate>
            <volume>72</volume>
            <issue>5</issue>
            <fpage>4231</fpage>
            <lpage>4236</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">109652</pubid>
                  <pubid idtype="pmpid" link="fulltext">9557712</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Infection of colonic epithelial cell lines by type 1 human immunodeficiency virus is associated with cell surface expression of galactosylceramide, a potential alternative gp120 receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Fantini</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cook</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Nathanson</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Spitalnik</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Gonzalez-Scarano</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1993</pubdate>
            <volume>90</volume>
            <issue>7</issue>
            <fpage>2700</fpage>
            <lpage>2704</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">46163</pubid>
                  <pubid idtype="pmpid" link="fulltext">8464878</pubid>
                  <pubid idtype="doi">10.1073/pnas.90.7.2700</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>R5- and X4-HIV-1 use differentially the endometrial epithelial cells HEC-1A to ensure their own spread: implication for mechanisms of sexual transmission</p>
            </title>
            <aug>
               <au>
                  <snm>Saidi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Magri</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Nasreddine</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Requena</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Belec</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2007</pubdate>
            <volume>358</volume>
            <issue>1</issue>
            <fpage>55</fpage>
            <lpage>68</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virol.2006.07.029</pubid>
                  <pubid idtype="pmpid" link="fulltext">16934308</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Syndecan captures, protects, and transmits HIV to T lymphocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Bobardt</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Saphire</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Hung</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Van der Schueren</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>David</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Gallay</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>Immunity</source>
            <pubdate>2003</pubdate>
            <volume>18</volume>
            <issue>1</issue>
            <fpage>27</fpage>
            <lpage>39</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1074-7613(02)00504-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">12530973</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Cell-free human immunodeficiency virus type 1 transcytosis through primary genital epithelial cells</p>
            </title>
            <aug>
               <au>
                  <snm>Bobardt</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Chatterji</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Selvarajah</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Van der Schueren</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>David</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kahn</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Gallay</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2007</pubdate>
            <volume>81</volume>
            <issue>1</issue>
            <fpage>395</fpage>
            <lpage>405</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1797244</pubid>
                  <pubid idtype="pmpid" link="fulltext">17050597</pubid>
                  <pubid idtype="doi">10.1128/JVI.01303-06</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>A mannose-binding receptor is expressed on human keratinocytes and mediates killing of Candida albicans</p>
            </title>
            <aug>
               <au>
                  <snm>Szolnoky</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Bata-Csorgo</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Kenderessy</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Kiss</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pivarcsi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Novak</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Nagy Newman</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Michel</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ruzicka</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Marodi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Dobozy</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kemeny</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Invest Dermatol</source>
            <pubdate>2001</pubdate>
            <volume>117</volume>
            <issue>2</issue>
            <fpage>205</fpage>
            <lpage>213</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1523-1747.2001.14071.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11511295</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>CD4-independent infection of astrocytes by human immunodeficiency virus type 1: requirement for the human mannose receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>BO</fnm>
               </au>
               <au>
                  <snm>Gattone</snm>
                  <fnm>VH</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nath</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Blum</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2004</pubdate>
            <volume>78</volume>
            <issue>8</issue>
            <fpage>4120</fpage>
            <lpage>4133</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">374297</pubid>
                  <pubid idtype="pmpid" link="fulltext">15047828</pubid>
                  <pubid idtype="doi">10.1128/JVI.78.8.4120-4133.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Co-expression of CXCR4/fusin and galactosylceramide in the human intestinal epithelial cell line HT-29</p>
            </title>
            <aug>
               <au>
                  <snm>Delezay</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Yahi</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hammache</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Tourres</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tamalet</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Fantini</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Aids</source>
            <pubdate>1997</pubdate>
            <volume>11</volume>
            <issue>11</issue>
            <fpage>1311</fpage>
            <lpage>1318</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00002030-199711000-00004</pubid>
                  <pubid idtype="pmpid" link="fulltext">9302439</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Transcytosis of infectious human immunodeficiency virus across a tight human epithelial cell line barrier</p>
            </title>
            <aug>
               <au>
                  <snm>Bomsel</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>1997</pubdate>
            <volume>3</volume>
            <issue>1</issue>
            <fpage>42</fpage>
            <lpage>47</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm0197-42</pubid>
                  <pubid idtype="pmpid">8986739</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Enhanced transcytosis of R5-tropic human immunodeficiency virus across tight monolayer of polarized human endometrial cells under pro-inflammatory conditions</p>
            </title>
            <aug>
               <au>
                  <snm>Carreno</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Krieff</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Irinopoulou</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kazatchkine</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Belec</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Cytokine</source>
            <pubdate>2002</pubdate>
            <volume>20</volume>
            <issue>6</issue>
            <fpage>289</fpage>
            <lpage>294</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/cyto.2002.2009</pubid>
                  <pubid idtype="pmpid" link="fulltext">12633571</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Down-regulation of CXCR4 by human herpesvirus 6 (HHV-6) and HHV-7</p>
            </title>
            <aug>
               <au>
                  <snm>Yasukawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sakai</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Ohminami</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Arai</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kaneko</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yakushijin</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Maeyama</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakashima</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Arakaki</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Fujita</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>1999</pubdate>
            <volume>162</volume>
            <issue>9</issue>
            <fpage>5417</fpage>
            <lpage>5422</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10228019</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Progressive and persistent downregulation of surface CXCR4 in CD4(+) T cells infected with human herpesvirus 7</p>
            </title>
            <aug>
               <au>
                  <snm>Secchiero</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zella</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Barabitskaja</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Reitz</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Capitani</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gallo</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Zauli</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1998</pubdate>
            <volume>92</volume>
            <issue>12</issue>
            <fpage>4521</fpage>
            <lpage>4528</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9845516</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Calprotectin expression in vitro by oral epithelial cells confers resistance to infection by Porphyromonas gingivalis</p>
            </title>
            <aug>
               <au>
                  <snm>Nisapakultorn</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ross</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Herzberg</snm>
                  <fnm>MC</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2001</pubdate>
            <volume>69</volume>
            <issue>7</issue>
            <fpage>4242</fpage>
            <lpage>4247</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">98457</pubid>
                  <pubid idtype="pmpid" link="fulltext">11401960</pubid>
                  <pubid idtype="doi">10.1128/IAI.69.7.4242-4247.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>A small-molecule, nonpeptide CCR5 antagonist with highly potent and selective anti-HIV-1 activity</p>
            </title>
            <aug>
               <au>
                  <snm>Baba</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nishimura</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Kanzaki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Okamoto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sawada</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Iizawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shiraishi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Aramaki</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Okonogi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ogawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Meguro</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Fujino</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <issue>10</issue>
            <fpage>5698</fpage>
            <lpage>5703</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">21923</pubid>
                  <pubid idtype="pmpid" link="fulltext">10318947</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.10.5698</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Tuberculosis and HIV co-infection: a practical therapeutic approach</p>
            </title>
            <aug>
               <au>
                  <snm>Breen</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Swaden</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Ballinger</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lipman</snm>
                  <fnm>MC</fnm>
               </au>
            </aug>
            <source>Drugs</source>
            <pubdate>2006</pubdate>
            <volume>66</volume>
            <issue>18</issue>
            <fpage>2299</fpage>
            <lpage>2308</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2165/00003495-200666180-00003</pubid>
                  <pubid idtype="pmpid">17181373</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Impact of human immune deficiency virus infection on hepatitis C virus infection and replication</p>
            </title>
            <aug>
               <au>
                  <snm>Parodi</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Belmonte</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bare</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>de Bracco</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Ruibal-Ares</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Curr HIV Res</source>
            <pubdate>2007</pubdate>
            <volume>5</volume>
            <issue>1</issue>
            <fpage>55</fpage>
            <lpage>67</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2174/157016207779316341</pubid>
                  <pubid idtype="pmpid">17266557</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Liver disease as a major cause of death among HIV infected patients: role of hepatitis C and B viruses and alcohol</p>
            </title>
            <aug>
               <au>
                  <snm>Salmon-Ceron</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lewden</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Morlat</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bevilacqua</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jougla</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bonnet</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Heripret</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Costagliola</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>May</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Chene</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Hepatol</source>
            <pubdate>2005</pubdate>
            <volume>42</volume>
            <issue>6</issue>
            <fpage>799</fpage>
            <lpage>805</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jhep.2005.01.022</pubid>
                  <pubid idtype="pmpid">15973779</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Clinical and therapeutic issues for herpes simplex virus-2 and HIV co-infection</p>
            </title>
            <aug>
               <au>
                  <snm>Lingappa</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Celum</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Drugs</source>
            <pubdate>2007</pubdate>
            <volume>67</volume>
            <issue>2</issue>
            <fpage>155</fpage>
            <lpage>174</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2165/00003495-200767020-00001</pubid>
                  <pubid idtype="pmpid">17284082</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Characterization of sexually transmitted disease clinic patients with recent human immunodeficiency virus infection</p>
            </title>
            <aug>
               <au>
                  <snm>Schwarcz</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Kellogg</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>McFarland</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Louie</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Klausner</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Withum</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Katz</snm>
                  <fnm>MH</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2002</pubdate>
            <volume>186</volume>
            <issue>7</issue>
            <fpage>1019</fpage>
            <lpage>1022</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/342954</pubid>
                  <pubid idtype="pmpid" link="fulltext">12232844</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Synergism between HIV and other viruses in the mouth</p>
            </title>
            <aug>
               <au>
                  <snm>Mbopi-Keou</snm>
                  <fnm>FX</fnm>
               </au>
               <au>
                  <snm>Belec</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Teo</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Scully</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Porter</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>Lancet Infect Dis</source>
            <pubdate>2002</pubdate>
            <volume>2</volume>
            <issue>7</issue>
            <fpage>416</fpage>
            <lpage>424</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1473-3099(02)00317-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">12127353</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Expression of the peptide antibiotic human beta-defensin 1 in cultured gingival epithelial cells and gingival tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Krisanaprakornkit</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Weinberg</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Perez</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Dale</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1998</pubdate>
            <volume>66</volume>
            <issue>9</issue>
            <fpage>4222</fpage>
            <lpage>4228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">108509</pubid>
                  <pubid idtype="pmpid" link="fulltext">9712771</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Dual infection with HIV and malaria fuels the spread of both diseases in sub-Saharan Africa</p>
            </title>
            <aug>
               <au>
                  <snm>Abu-Raddad</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Patnaik</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kublin</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2006</pubdate>
            <volume>314</volume>
            <issue>5805</issue>
            <fpage>1603</fpage>
            <lpage>1606</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1132338</pubid>
                  <pubid idtype="pmpid" link="fulltext">17158329</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Human immunodeficiency virus (HIV) and malaria interaction in sub-Saharan Africa: the collision of two Titans</p>
            </title>
            <aug>
               <au>
                  <snm>Idemyor</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>HIV Clin Trials</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <issue>4</issue>
            <fpage>246</fpage>
            <lpage>253</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1310/hct0804-246</pubid>
                  <pubid idtype="pmpid" link="fulltext">17720665</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Trichomonas vaginalis-induced epithelial monolayer disruption and human immunodeficiency virus type 1 (HIV-1) replication: implications for the sexual transmission of HIV-1</p>
            </title>
            <aug>
               <au>
                  <snm>Guenthner</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Secor</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Dezzutti</snm>
                  <fnm>CS</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2005</pubdate>
            <volume>73</volume>
            <issue>7</issue>
            <fpage>4155</fpage>
            <lpage>4160</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1168584</pubid>
                  <pubid idtype="pmpid" link="fulltext">15972505</pubid>
                  <pubid idtype="doi">10.1128/IAI.73.7.4155-4160.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Real-time polymerase chain reaction for detection and quantification of bacteria in periodontal patients</p>
            </title>
            <aug>
               <au>
                  <snm>Nonnenmacher</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dalpke</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rochon</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Flores-de-Jacoby</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Mutters</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Heeg</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Periodontol</source>
            <pubdate>2005</pubdate>
            <volume>76</volume>
            <issue>9</issue>
            <fpage>1542</fpage>
            <lpage>1549</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1902/jop.2005.76.9.1542</pubid>
                  <pubid idtype="pmpid">16171445</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Modulation of cytokine production by Porphyromonas gingivalis in a macrophage and epithelial cell co-culture model</p>
            </title>
            <aug>
               <au>
                  <snm>Bodet</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Chandad</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Grenier</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Microbes Infect</source>
            <pubdate>2005</pubdate>
            <volume>7</volume>
            <issue>3</issue>
            <fpage>448</fpage>
            <lpage>456</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.micinf.2004.11.021</pubid>
                  <pubid idtype="pmpid" link="fulltext">15811635</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Efficient induction of HIV-1 replication in latently infected cells through contact with CD4(+) T cells: Involvement of NF-kappaB activation</p>
            </title>
            <aug>
               <au>
                  <snm>Qi</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Koya</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Saitoh</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Saitoh</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shimizu</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ohba</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Yamaoka</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2007</pubdate>
            <volume>361</volume>
            <issue>2</issue>
            <fpage>325</fpage>
            <lpage>334</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virol.2006.11.014</pubid>
                  <pubid idtype="pmpid" link="fulltext">17222438</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Characterization of dendritic cells from human oral mucosa: a new Langerhans' cell type with high constitutive FcepsilonRI expression</p>
            </title>
            <aug>
               <au>
                  <snm>Allam</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Novak</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fuchs</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Asen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Berge</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Appel</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Geiger</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kochan</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Bieber</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2003</pubdate>
            <volume>112</volume>
            <issue>1</issue>
            <fpage>141</fpage>
            <lpage>148</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mai.2003.1607</pubid>
                  <pubid idtype="pmpid" link="fulltext">12847491</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Langerhans cells from human oral epithelium are more effective at stimulating allogeneic T cells in vitro than Langerhans cells from skin</p>
            </title>
            <aug>
               <au>
                  <snm>Hasseus</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Jontell</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bergenholtz</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Dahlgren</snm>
                  <fnm>UI</fnm>
               </au>
            </aug>
            <source>Clin Exp Immunol</source>
            <pubdate>2004</pubdate>
            <volume>136</volume>
            <issue>3</issue>
            <fpage>483</fpage>
            <lpage>489</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1809065</pubid>
                  <pubid idtype="pmpid" link="fulltext">15147350</pubid>
                  <pubid idtype="doi">10.1111/j.1365-2249.2004.02469.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Cyclophilin a plays distinct roles in human immunodeficiency virus type 1 entry and postentry events, as revealed by spinoculation</p>
            </title>
            <aug>
               <au>
                  <snm>Saphire</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Bobardt</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Gallay</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2002</pubdate>
            <volume>76</volume>
            <issue>9</issue>
            <fpage>4671</fpage>
            <lpage>4677</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">155090</pubid>
                  <pubid idtype="pmpid" link="fulltext">11932436</pubid>
                  <pubid idtype="doi">10.1128/JVI.76.9.4671-4677.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells</p>
            </title>
            <aug>
               <au>
                  <snm>Geijtenbeek</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Kwon</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Torensma</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>van Vliet</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>van Duijnhoven</snm>
                  <fnm>GC</fnm>
               </au>
               <au>
                  <snm>Middel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cornelissen</snm>
                  <fnm>IL</fnm>
               </au>
               <au>
                  <snm>Nottet</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>KewalRamani</snm>
                  <fnm>VN</fnm>
               </au>
               <au>
                  <snm>Littman</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Figdor</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>van Kooyk</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2000</pubdate>
            <volume>100</volume>
            <issue>5</issue>
            <fpage>587</fpage>
            <lpage>597</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)80694-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">10721995</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Inhibition of human immunodeficiency virus type 1 entry by a binding domain of Porphyromonas gingivalis gingipain</p>
            </title>
            <aug>
               <au>
                  <snm>Xie</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Belogortseva</snm>
                  <fnm>NI</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>CH</fnm>
               </au>
            </aug>
            <source>Antimicrob Agents Chemother</source>
            <pubdate>2006</pubdate>
            <volume>50</volume>
            <issue>9</issue>
            <fpage>3070</fpage>
            <lpage>3074</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1563519</pubid>
                  <pubid idtype="pmpid" link="fulltext">16940103</pubid>
                  <pubid idtype="doi">10.1128/AAC.01578-05</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Involvement of clathrin-mediated endocytosis in human immunodeficiency virus type 1 entry</p>
            </title>
            <aug>
               <au>
                  <snm>Daecke</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fackler</snm>
                  <fnm>OT</fnm>
               </au>
               <au>
                  <snm>Dittmar</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Krausslich</snm>
                  <fnm>HG</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2005</pubdate>
            <volume>79</volume>
            <issue>3</issue>
            <fpage>1581</fpage>
            <lpage>1594</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">544101</pubid>
                  <pubid idtype="pmpid" link="fulltext">15650184</pubid>
                  <pubid idtype="doi">10.1128/JVI.79.3.1581-1594.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Cytosolic Gag p24 as an index of productive entry of human immunodeficiency virus type 1</p>
            </title>
            <aug>
               <au>
                  <snm>Marechal</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Clavel</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Heard</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>O</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1998</pubdate>
            <volume>72</volume>
            <issue>3</issue>
            <fpage>2208</fpage>
            <lpage>2212</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">109517</pubid>
                  <pubid idtype="pmpid" link="fulltext">9499078</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Human immunodeficiency virus type 1 entry into macrophages mediated by macropinocytosis</p>
            </title>
            <aug>
               <au>
                  <snm>Marechal</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Prevost</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Petit</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Perret</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Heard</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>O</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2001</pubdate>
            <volume>75</volume>
            <issue>22</issue>
            <fpage>11166</fpage>
            <lpage>11177</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">114696</pubid>
                  <pubid idtype="pmpid" link="fulltext">11602756</pubid>
                  <pubid idtype="doi">10.1128/JVI.75.22.11166-11177.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses</p>
            </title>
            <aug>
               <au>
                  <snm>Geijtenbeek</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Torensma</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>van Vliet</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>van Duijnhoven</snm>
                  <fnm>GC</fnm>
               </au>
               <au>
                  <snm>Adema</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>van Kooyk</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Figdor</snm>
                  <fnm>CG</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2000</pubdate>
            <volume>100</volume>
            <issue>5</issue>
            <fpage>575</fpage>
            <lpage>585</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)80693-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">10721994</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Immunodeficiency virus uptake, turnover, and 2-phase transfer in human dendritic cells</p>
            </title>
            <aug>
               <au>
                  <snm>Turville</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Santos</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Frank</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Cameron</snm>
                  <fnm>PU</fnm>
               </au>
               <au>
                  <snm>Wilkinson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Miranda-Saksena</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dable</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Stossel</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Romani</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Piatak</snm>
                  <fnm>M</fnm>
                  <suf>Jr.</suf>
               </au>
               <au>
                  <snm>Lifson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Pope</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cunningham</snm>
                  <fnm>AL</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2004</pubdate>
            <volume>103</volume>
            <issue>6</issue>
            <fpage>2170</fpage>
            <lpage>2179</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2003-09-3129</pubid>
                  <pubid idtype="pmpid" link="fulltext">14630806</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Dental plaque: biological significance of a biofilm and community life-style</p>
            </title>
            <aug>
               <au>
                  <snm>Marsh</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>J Clin Periodontol</source>
            <pubdate>2005</pubdate>
            <volume>32 Suppl 6</volume>
            <fpage>7</fpage>
            <lpage>15</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-051X.2005.00790.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16128825</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>p38 MAPK-dependent and YY1-mediated chemokine receptors CCR5 and CXCR4 up-regulation in U937 cell line infected by Mycobacterium tuberculosis or Actinobacillus actinomycetemcomitans</p>
            </title>
            <aug>
               <au>
                  <snm>Lei</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2005</pubdate>
            <volume>329</volume>
            <issue>2</issue>
            <fpage>610</fpage>
            <lpage>615</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2005.02.022</pubid>
                  <pubid idtype="pmpid" link="fulltext">15737629</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>The molecular basis of nonoxynol-9-induced vaginal inflammation and its possible relevance to human immunodeficiency virus type 1 transmission</p>
            </title>
            <aug>
               <au>
                  <snm>Fichorova</snm>
                  <fnm>RN</fnm>
               </au>
               <au>
                  <snm>Tucker</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2001</pubdate>
            <volume>184</volume>
            <issue>4</issue>
            <fpage>418</fpage>
            <lpage>428</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/322047</pubid>
                  <pubid idtype="pmpid" link="fulltext">11471099</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>HIV and inflammation</p>
            </title>
            <aug>
               <au>
                  <snm>Decrion</snm>
                  <fnm>AZ</fnm>
               </au>
               <au>
                  <snm>Dichamp</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Varin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Herbein</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Curr HIV Res</source>
            <pubdate>2005</pubdate>
            <volume>3</volume>
            <issue>3</issue>
            <fpage>243</fpage>
            <lpage>259</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2174/1570162054368057</pubid>
                  <pubid idtype="pmpid">16022656</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Influence of coinfecting pathogens on HIV expression: evidence for a role of Toll-like receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Bafica</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Scanga</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Schito</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Chaussabel</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Sher</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2004</pubdate>
            <volume>172</volume>
            <issue>12</issue>
            <fpage>7229</fpage>
            <lpage>7234</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15187096</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Bacterial lipopolysaccharide activates HIV long terminal repeat through Toll-like receptor 4</p>
            </title>
            <aug>
               <au>
                  <snm>Equils</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Faure</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bulut</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Trushin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Arditi</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2001</pubdate>
            <volume>166</volume>
            <issue>4</issue>
            <fpage>2342</fpage>
            <lpage>2347</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11160291</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics</p>
            </title>
            <aug>
               <au>
                  <snm>Dickson</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Hahn</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Ino</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ronfard</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>JY</fnm>
               </au>
               <au>
                  <snm>Weinberg</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Louis</snm>
                  <fnm>DN</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>FP</fnm>
               </au>
               <au>
                  <snm>Rheinwald</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>2000</pubdate>
            <volume>20</volume>
            <issue>4</issue>
            <fpage>1436</fpage>
            <lpage>1447</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">85304</pubid>
                  <pubid idtype="pmpid" link="fulltext">10648628</pubid>
                  <pubid idtype="doi">10.1128/MCB.20.4.1436-1447.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Human oral epithelial cell culture I. Improved conditions for reproducible culture in serum-free medium</p>
            </title>
            <aug>
               <au>
                  <snm>Oda</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Watson</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>In Vitro Cell Dev Biol</source>
            <pubdate>1990</pubdate>
            <volume>26</volume>
            <issue>6</issue>
            <fpage>589</fpage>
            <lpage>595</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF02624208</pubid>
                  <pubid idtype="pmpid">2358421</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Emergence of resistant human immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20) monotherapy</p>
            </title>
            <aug>
               <au>
                  <snm>Wei</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Decker</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Arani</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Kilby</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Saag</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Shaw</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Kappes</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Antimicrob Agents Chemother</source>
            <pubdate>2002</pubdate>
            <volume>46</volume>
            <issue>6</issue>
            <fpage>1896</fpage>
            <lpage>1905</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">127242</pubid>
                  <pubid idtype="pmpid" link="fulltext">12019106</pubid>
                  <pubid idtype="doi">10.1128/AAC.46.6.1896-1905.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>T4 positive human neoplastic cell lines susceptible to and permissive for HTLV-III</p>
            </title>
            <aug>
               <au>
                  <snm>Popovic</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Read-Connole</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Gallo</snm>
                  <fnm>RC</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>1984</pubdate>
            <volume>2</volume>
            <issue>8417-18</issue>
            <fpage>1472</fpage>
            <lpage>1473</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(84)91666-0</pubid>
                  <pubid idtype="pmpid">6151082</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B70">
            <title>
               <p>The role of mononuclear phagocytes in HTLV-III/LAV infection</p>
            </title>
            <aug>
               <au>
                  <snm>Gartner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Markovits</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Markovitz</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Kaplan</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Gallo</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Popovic</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1986</pubdate>
            <volume>233</volume>
            <issue>4760</issue>
            <fpage>215</fpage>
            <lpage>219</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.3014648</pubid>
                  <pubid idtype="pmpid" link="fulltext">3014648</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>A simple method of estimating fifty per cent endpoint.</p>
            </title>
            <aug>
               <au>
                  <snm>Reed</snm>
                  <fnm>LJ</fnm>
                  <suf>Muench, H.</suf>
               </au>
            </aug>
            <source>Am J Hyg</source>
            <pubdate>1938</pubdate>
            <volume>27</volume>
            <fpage>493</fpage>
            <lpage>497</lpage>
         </bibl>
         <bibl id="B72">
            <title>
               <p>Rapid human metapneumovirus microneutralization assay based on green fluorescent protein expression</p>
            </title>
            <aug>
               <au>
                  <snm>Biacchesi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Skiadopoulos</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Collins</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Buchholz</snm>
                  <fnm>UJ</fnm>
               </au>
            </aug>
            <source>J Virol Methods</source>
            <pubdate>2005</pubdate>
            <volume>128</volume>
            <issue>1-2</issue>
            <fpage>192</fpage>
            <lpage>197</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jviromet.2005.05.005</pubid>
                  <pubid idtype="pmpid" link="fulltext">15955576</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Spiral plate method for bacterial determination</p>
            </title>
            <aug>
               <au>
                  <snm>Gilchrist</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Donnelly</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Peeler</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Delaney</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Appl Microbiol</source>
            <pubdate>1973</pubdate>
            <volume>25</volume>
            <issue>2</issue>
            <fpage>244</fpage>
            <lpage>252</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">380780</pubid>
                  <pubid idtype="pmpid">4632851</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B74">
            <title>
               <p>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method</p>
            </title>
            <aug>
               <au>
                  <snm>Livak</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Schmittgen</snm>
                  <fnm>TD</fnm>
               </au>
            </aug>
            <source>Methods</source>
            <pubdate>2001</pubdate>
            <volume>25</volume>
            <issue>4</issue>
            <fpage>402</fpage>
            <lpage>408</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/meth.2001.1262</pubid>
                  <pubid idtype="pmpid" link="fulltext">11846609</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

