Rat T cell lines, FPM1 25 and C58(NT)D (ATCC TIB-236), a rat macrophage line, NR8383 (ATCC CRL-2192), and human T cell lines, Jurkat and Molt4R5, were used for propagation of HIV-1. TZM-bl cells were used to measure the infectivity of HIV-1 according to previously described procedures 26. NR8383hCRM1, FPM1hCRM1, FPM1hCT, and FPM1hCT/hCRM1 expressing hCRM1, hCycT1, or both were constructed as described previously 40.

To construct hemagglutinin (HA)-tagged hCycT1, pβCycT, which harbors the human cyclinT1 cDNA in the pCXN2 vector, was used as a template for PCR with forward (5'-ggtctagagcactatggagggagagaggaag-3') and reverse (5'-gggaattcatgcatagtctggtacatcgtaggggtacttaggaaggggtggaagtggtgg-3') primers with the following amplification conditions: 2 min at 94°C, 30 cycles of 30 s at 94°C, 60 s at 64°C, 2.5 min at 72°C, and a final extension for 10 min at 72°C. The amplified DNA was digested and inserted between the EcoRI and XbaI sites of pCXN2 41.

Rat Cyclin T1 mRNA was extracted from rat ER-1 neo1 cells using the Absolute RNA extraction Kit (Stratagene) and amplified by RT-PCR using the following primers: 5'-ccgaattcaagcactatggagggagagaggaa-3' and 5'-ccgaattcatgcatagtctggtacatcgtaggggtacttaggaagaggtggaagaggtgg-3'. The amplification conditions were: 94°C for 2 min, 30 cycles of 15 s at 94°C, 30s at 60°C, 2.5 min at 68°C, and a final extension for 5 min at 68°C. The amplified DNA was digested and inserted into the EcoRI site of pCXN2.

To construct pSRαrCRM1-HA, pSRαrCRM1 was used for PCR with the following primers: 5'-ctggaatcacttggcagctgagctctacagagagagtcca-3' and 5'-tatggtaccttaagcataatcaggaacatcgtatgggtagtcacacatttcttctgggatttc-3'. The amplification conditions were: 2 min at 94°C, 20 cycles of 30 s at 94°C, 1 min at 62°C, 2 min at 68°C, and a final extension for 10 min at 68°C. The amplified DNA was digested and inserted into the SacI and KpnI sites of pSRαrCRM1.

The following plasmids were used in this study: pSRα296 42; pCRRE 35; pΔpol 24; pMaxGFP (Amaxa) and pCDMβ-gal 43; pNL4-3 30; pYU-2 28; p89.6 32; pLAI-2 31; pYK-JRCSF 27; and pNLAD8-EGFP 29. pH1-luc (a gift from Dr. A. Adachi) contains a luciferase coding sequence downstream of the HIV-1 LTR. pSRαhCRM1-HA was a gift from Dr. T. Kimura.

An hCycT1 BAC (RZPD;RZPDB737F032099D) was microinjected into fertilized rat (F344) eggs. To identify Tg rats, total genomic DNA extracted from rat tail snips was examined by PCR using two sets of PCR primers with one primer annealing the BAC backbone vector and the other annealing the 5' or 3' end of hCyclin T1 genomic DNA. Primers CTB3 (gccaacgctcaatccggttctcgc) and CTGB3 (gctattttccagctgttctcgagtg) were used for the 5' end. Primers CTB4 (ttattccctagtccaaggatgac) and CTGB4 (cagacaatagactatcaagacactgtg) were used for the 3' end. PCR was performed using 500 ng of DNA as a template with the following amplification conditions: 94°C for 2 min, 30 cycles of denaturation (94°C for 1 min), annealing (58°C for the 5' end primers and 54°C for the 3' end primers, 30s), extension (72°C, 1 min), and a final extension (72°C, 5 min).

Rat primary T cells were enriched from splenocytes using a nylon wool column. More than 95% of the cells were CD3⁺ cells, as evaluated by Flow Cytometry (FACS Calibur; Becton Dickinson). The cells were stimulated for 2 days with an anti-rat CD3 mAb (5 μg/ml) and an anti-rat CD28 mAb (0.5 μg/ml) that had been coated on the culture plates. CD4⁺T cells were then isolated by negative selection using anti-rat CD8 MicroBeads (Miltenyi Biotec). Isolated CD4⁺CD8^- T cells were >90% pure, as determined by staining with anti-rat-CD4 (BD Biosciences Pharmingen) and anti-rat-CD8 (BD Biosciences Pharmingen).

Rat peritoneal macrophages were isolated from rats that had been treated with 3% thioglycollate for 3 days. The macrophages were coated with anti-rat CD11b and isolated using goat anti-mouse IgG MicroBeads (Miltenyi Biotec). Isolated CD11b⁺ peritoneal cells were >90% pure, as determined by staining with mouse anti-rat-ED2 (BD Biosciences). Isolated CD11b⁺ ED2⁺ peritoneal cells were cultured for 2 h at 37°C to allow them to adhere to the plates.

Human peripheral blood mononuclear cells (PBMCs) were isolated from healthy donors using Ficoll Paque Plus (Amersham Biotechnology) density centrifugation. The cells were activated with 5 μg/ml phytohemagglutinin-P (PHA-P) (SIGMA) and 20 U/ml IL-2 (PeproTech EC) for 3 days at 37°C. Peripheral blood lymphocytes (hPBLs) were harvested as non-adherent cells.

Human monocytes were isolated from PBMCs using anti-CD14 conjugated to magnetic beads (Miltenyi Biotec), and allowed to adhere on dishes at 37°C for 1 h in RPMI 1640 supplemented with 1% human serum. Human monocyte-derived macrophages (MDMs) were then generated by incubation in RPMI 1640 supplemented with 15% FBS, antibiotics, and GM-CSF (10 U/ml) (R & D) for 5 days.

Cell lines (2 × 10⁶) and primary T cells (1 × 10⁷) were electroporated in 100 μl of Nucleofector Solution (Cell line Solution V, Mouse T cell and human T cell Nucleofector kit, Amaxa Biosystems,) using the conditions (FPM1;T-03, C58(NT)D;T-20, NR8383;T-27, and rat primary T;X-01, Jurkat;X-01, Molt4R5;A-30, hPBL;U-14) and plasmids described in the Figure Legends. After 48 h, p24 in the supernatant and in cells was quantified using a p24 ELISA kit (Zeptometrix). In some cases, the viruses were concentrated by centrifugation at 15,000 rpm for 90 min in a microcentrifuge and p24 was quantitatively recovered from the pellets.

Cells were lysed in buffer containing 10 mM Tris-HCl, pH 7.4, 1 mM MgCl₂, 0.5% NP40, and protease inhibitors or sample buffer without mercaptoethanol and dye, and protein concentrations were determined by BCA assay. Samples containing 50 μg protein were then subjected to Western blotting using anti-CycT1 (Novocastra Laboratories Ltd), anti-CRM1 42, anti-HA (Behringer), or anti-β-actin (SIGMA).

Rat peritoneal macrophages and human MDMs were seeded at a density of 5 × 10⁵ cells/well in 24 well plates and cultured for 1 day at 37°C. Macrophages were then inoculated with VSV-G-coated NL43 and NLAD8-EGFP (50 ng), which were prepared by transfection of pNL4-3 or pNLAD8-EGFP along with pVSV-G to 293 T cells with Fugene6, in the absence or presence of 20 μM PMPA 44 overnight at 37°C. Finally, cells were washed gently 5 times and 2 ml of RPMI containing 15% FCS with or without PMPA was added.

Since controversial results regarding the activity of Tat in rat cells have been reported, we compared the effect of hCycT1 versus rCycT1expression in rat T cells. To express the HIV-1 genome and CycT1 in rat T cells, we used the electroporation of CycT1 and an HIV-1 genome expressing plasmid, since we experienced very low rates of HIV-1 infection even with VSV-G coated particles. In our hands, electroporation was the only way to introduce enough HIV genome into rat T cells. We co-electroporated pMax-GFP or pCDM-βgal to monitor the efficiency of electroporation. When we electroporated pΔpol, which was constructed by deleting 328 base pairs in the pol gene of the infectious pNL43 genome 24, and HA-tagged hCycT1 or rCycT1 into FPM1 cells, a rat CD4⁺ T cell line transformed with HTLV-1 25, Gag p24 production was enhanced several fold in the presence of hCycT1-HA. However, hCycT1 expression was very low. In contrast, rCycT1-HA was efficiently expressed, but did not alter Gag p24 production. Since hCycT1-HA may be unstable, we next used an untagged hCycT1 for co-electroporation. We detected a 40 fold enhancement of Gag production in the presence of hCycT1 (Fig. 1A). The band corresponding to hCycT1 was, however, hardly detected by Western blot analysis (data not shown). The reason why untagged hCycT1 enhanced expression more efficiently than hCycT1-HA is currently unclear, because the intracellular amounts of these hCycT1s cannot be exactly compared due to the different abilities of the anti-HA mAb and anti-hCycT1 antibody.

Next, to assess Rev activity in rat T cells, we compared the effects of hCRM1 and rCRM1 on HIV-1 propagation. When we electroporated HA-tagged CRM1 expression plasmids and pΔpol into FPM1 cells, p24 production was not significantly increased. The level of hCRM1-HA detected by Western blotting was very low. However, we reproducibly observed a 2–4 fold enhancement of p24 production in cells transiently expressing untagged hCRM1, but not rCRM1 (Fig. 1B). These results suggest that endogenous rCRM1 supports p24 production less efficiently than the hCRM1 and that Rev function is not absolutely blocked in rat T cells. To examine the stability of CRM1-HA, we added cycloheximide to inhibit translation in CRM1-transfected T cells and examined CRM1 protein levels over time. In both rat and human T cells, hCRM1-HA was much less stable than rCRM1-HA (Fig. 1C), partly accounting for the lower amounts of hCRM1 (See Fig. 1B).

To examine the effects of both hCycT1 and hCRM1 on HIV-1 propagation in rat T cells, including FPM1 and C58(NT)D cells, we co-electroporated these expression plasmids with pΔpol. Additionally, we co-transfected pH1-Luc, which expresses the luciferase gene driven by the HIV-1 LTR, to examine the effect of hCycT1 and hCRM1 on Tat-directed gene expression. Expression of hCycT1, but not hCRM1, enhanced LTR-derived expression several fold, consistent with the previously reported functions of these proteins. Notably, the enhancement of p24 production by hCycT1 was substantially greater than that of the luciferase activity. Furthermore, levels of extracellular p24 were more enriched than intracellular levels, and hCycT1 synergistically cooperated with hCRM1 to augment the synthesis of p24 by approximately 100 fold (Fig. 2A and 2B). These results suggest that hCycT1 enhanced the transcription of the LTR-driven HIV-1 pre-mRNA. Since the pre-mRNA is the source of mRNAs encoding Gag, Tat and Rev, its increase may trigger positive feedback in the synthesis of HIV-1 pre-mRNA as a result of increased Tat protein levels and in the amounts of unspliced mRNA as a result of increased Rev protein levels. Thus, Gag would be produced much more efficiently than luciferase. Subsequently, the enhanced Gag expression facilitates the more efficient release of viral particles. The level of p24 produced by rat T cells expressing both hCycT1 and hCRM1 was approximately 25–33% of the levels produced by the human T cell line Molt4 (data not shown).

To examine the effect of hCycT1 and hCRM1 on HIV-1 propagation using a full length HIV-1 clone, we electroporated pNL4-3 into FPM1 T cells that continuously expressed hCycT1 and hCRM1, and then quantified the production of p24. Again, hCycT1 greatly augmented p24 production, and hCRM1 had a moderate effect. Notably, the levels of hCycT1 and hCRM1 expression in FPM1 cells were similar to those in Molt4 cells (Fig. 2C). Thus, expression of these human factors should support robust HIV-1 propagation in rat T cells.

We examined the effect of hCycT1 and hCRM1 on p24 production and LTR-driven expression in the rat macrophage cell line NR8383, using the experimental approaches described above. Transient expression of rCRM1-HA in NR8383 cells did not affect p24 production, whereas hCRM1-HA enhanced p24 production 5–10 fold, although the level of hCRM1-HA expression was much less than that of rCRM1-HA (Fig. 3A). Expression of hCycT1 enhanced p24 production by only a few fold. The expression of hCycT1 was readily detected by Western blotting (Fig. 3B), in contrast to the low levels in rat T cells. Neither hCycT1 nor hCRM1 expression significantly affected luciferase expression driven by the HIV LTR (Fig. 3C). We also detected a greater than 10 fold enhancement of extracellular and intracellular p24 production in the presence of untagged hCRM1 (Fig. 3C), but not rCRM1 (data not shown). When hCycT1 and hCRM1 were co-expressed, they synergistically augmented p24 production by greater than 20–50 fold in NR8383 cells (Fig. 3B and 3C). The amount of extracellular p24 increased more than intracellular p24, as seen in T cells, suggesting that the increase in Gag expression facilitated more efficient release of viral particles. These results clearly indicate that hCRM1 augments p24 production in rat macrophages more efficiently than hCycT1, in contrast to the effects of the two proteins in rat T cell lines.

To investigate whether HIV-1 produced by rat cells is infectious, we electroporated infectious HIV-1 molecular clones into rat and human cells and evaluated the infectivity of the progeny viruses using the indicator TZM-bl cells, which express luciferase upon HIV infection 26. Luciferase activity versus inoculated p24 was used as a surrogate marker of infectivity. Interestingly, R5 viruses produced in rat T cells, including the JR-CSF 27, YU-2 28, and NL-AD8 29 strains, were equally infectious compared to those produced by human T cells, whereas rat T cell-derived ×4 and dual tropic viruses such as NL4-3 30, LAI-2 31, and 89.6 32 varied in their infectivity. In contrast, both R5 and ×4 viruses produced in the macrophage cell line exhibited infectivities comparable to those from human cells (Fig. 4).

To examine the role of hCycT1 in primary cells, we constructed transgenic (Tg) rats that express hCycT1. Since the regulation of cyclinT1 gene expression is complex 33, a BAC harboring the entire human cyclinT1 gene, which is assumed to contain all the regulatory sequences, was microinjected into fertilized rat eggs. To confirm the expression of hCycT1 in the Tg rats, cells isolated from both thymus and spleen were analyzed by Western blotting using anti-hCycT1. Thymocytes, but not splenocytes, of Tg rats expressed hCycT1 (Fig. 5A). Since hCycT1 is expressed during the activation of human lymphocytes 33, we stimulated the splenocytes with anti-CD3 and anti-CD28. Expression of hCycT1 was detected within 1 day and peaked 2 days after stimulation (Fig. 5B). Interestingly, rat splenocytes stimulated with phytohemaglutinin (PHA) and IL-2 did not express hCyCT1 (data not shown).

Expression of hCRM1 in Tg rats was also examined, using a previously established Tg rat 34. hCRM1 was expressed in both thymocytes and splenocytes activated with anti-CD3/CD28 (Fig. 5C). hCRM1 was not expressed in unstimulated splenocytes (data not shown), consistent with hCRM1 expression in human PBMC 34. We further characterized total T cells and CD4⁺CD8^- T cells prepared from double Tg rats in comparison to rat total T cells and human CD4⁺CD8^- T cells 2 days after stimulation. Both hCycT1 and hCRM1 were expressed in activated CD4⁺CD8^- T cells prepared from the Tg rat, similar to human CD4⁺CD8^- T cells (Fig. 5C and 5D). Both hCycT1 and hCRM1 were expressed in rat peritoneal macrophages at levels equivalent to expression in human monocyte-derived macrophages (MDMs) (Fig. 5E).

To investigate the effects of hCycT1 and hCRM1 on p24 production in primary T cells, we prepared T cells from splenocytes of wild-type (WT) and Tg rats and stimulated them with anti-CD3/CD28. As a control, isolated human PBLs were activated. In these experiments we used pCRRE 35, which harbors an HIV-1 genome with a deletion in the region from pol to vpr, instead of pΔpol 24, since introducing either pΔpol or the full-sized HIV-1 genome into the primary T cells by any method, including electroporation or VSV-G coated virus, had limited success.

T cells derived from hCycT1 Tg rats produced approximately 10–15 fold more p24 than WT T cells. In T cells derived from hCRM1 Tg rats, p24 production increased approximately 3 fold over WT cells. T cells-derived from hCycT1/CRM1 doubly Tg rats produced p24 at levels 24–40 fold greater than WT, and this level was ~40% of that produced by hPBLs (Fig. 6A). We further examined p24 production by CD4⁺CD8^- T cells prepared from double Tg rats in comparison to WT rat and human cells. CD4⁺CD8^- T cells prepared from double Tg rats produced p24 in the medium approximately 180 fold more efficiently than WT rat cells; this level was ~11% of the amount of p24 produced by human CD4⁺CD8^- T cells (Fig. 6C). These results indicate that the synergistic effects of hCycT1 and hCRM1 promoted the production of p24 in rat primary T cells ex vivo.

When intracellular p24 was evaluated by ELISA, increases of approximately 7 and 17 fold were observed in total T and CD4⁺CD8^- T cells, respectively (Fig. 6B and 6D), considerably less than the amount of extracellular p24 described above. The ratio of extracellular p24 to intracellular p24 increased gradually as p24 production increased, suggesting a more efficient virus release from the double Tg rat T cells compared to WT rat T cells.

To investigate HIV-1 propagation in macrophages derived from Tg rats, we prepared CD11b⁺ED2⁺ peritoneal macrophages and subsequently infected the cells using HIV-1 pseudotyped with VSV G protein. Although WT peritoneal macrophages produced a considerable amount of HIV-1 progeny virus in the absence of hCRM1 and hCycT1 expression, macrophages derived from hCycT1/CRM1 doubly Tg rats produced 6 fold higher levels of p24 at their peak (Fig. 7A). This level corresponds to 20% of the amount of p24 produced by human MDMs (data not shown). Macrophages from hCRM1 Tg rats supported a several fold increase in p24 production, but hCycT1 expression had a smaller effect. Macrophages treated with PMPA, a reverse transcriptase inhibitor, did not produce significant amounts of p24, confirming that the p24 measured represents production of progeny viruses and not inoculum. The amount of intracellular p24 also increased to some extent in the Tg rats, but to a lesser extent than p24 levels in the medium (Fig. 7B). Approximately 67% of the p24 synthesized in the doubly Tg cells was released into the medium and the ratio of extracellular p24 to intracellular p24 increased as viral production increased (Fig. 7C).

The infectivity of the viruses, which were harvested 5 days post infection, was evaluated using TZM-bl cells. Figure 7D shows that both R5 and ×4 viruses produced from rat macrophages retained infectivity levels similar to those from human PBLs and MDMs.