Bacterial expression vector pKBIN6Hthr 39 and viral IN shuttle vector pUCWTpol 40 were previously described. Because the IN tail overlaps the 5' end of vif, shuttle vector pUCWTpol3stop, which harbored three stop codons after Vif residue Asn-19, was constructed by PCR using Pfu Ultra DNA polymerase (Stratagene, La Jolla, CA) and primers AE1064 (5'-ACAGGATGAGGATTAACTGATGATAAGCTTTAGTAAAACACCATATG)/AE1065 (5'-CATATGGTGTTTTACTAAAGCTTATCATCAGTTAATCCTCATCCTGTC). IN deletion mutations were subsequently constructed in pUCWTpol3stop or pKBIN6Hthr by PCR. Plasmid pUCWTpolBam-Spe, which contains unique BamHI and SpeI sites downstream of the IN coding region and a stop codon after Arg-17 in Vif 41, was used to swap tail sequences as follows. AAA/CAG/ATG, which encodes for HIV-1 residues Lys-273, Gln-274, and Met-275, was changed to GGT/CGA/CTG to imbed a unique SalI site in pUCWTpolSal-Bam-Spe at the HIV-1/2 tail boundary. A linker constructed by annealing AE3697 (5'-PO₄-TCGACAGGAGATGGACAGCGGAAGTCACCTGGAGGGCGCAAGAGAGGACGGTGAGATGGCATAAG) with AE3698 (5'-PO₄-GATCCTTATGCCATCTCACCGTCCTCTCTTGCGCCCTCCAGGTGACTTCCGCTGTCCATCTCCTG) was then ligated to SalI/BamHI-digested pUCWTpolSal-Bam-Spe. To move the chimera tail to pKBIN6Hthr, pUCWTpolSal-Bam-Spe was amplified using XhoI-tagged AE3699 (5'-TGGTG

CTCGAG

CTTAAG

Escherichia coli strain PC2 43 transformed with IN expression constructs were grown for 16 h at 30°C. The next day bacteria subcultured at 1:30 in 600 ml LB-100 μg/ml ampicillin were grown at 30°C until A₆₀₀ of 0.6, at which time expression was induced by the addition of 0.6 mM isopropyl-β-D-thiogalactopyranoside. Cells were harvested following 5 h of induction at 28°C. The bacterial pellet resuspended in ice-cold buffer A [25 mM Tris-HCl, pH 7.4, 1 M NaCl, 7.5 mM 3-[(3-Cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonate (CHAPS)] containing 25 mM imidazole-0.5 mM phenylmethanesulphonylfluoride was sonicated. After centrifugation for 30 min at 39,000 g, the supernatant was incubated with 0.6 ml of buffer A-25 mM imidazole-equilibrated Ni²⁺-nitrilotriacetic acid (Ni-NTA) agarose beads (QIAGEN, Valencia, CA) at 4°C for 3 h. The beads were washed twice with 20 volumes of buffer A-25 mM imidazole followed by washing with 30 volumes of buffer A-35 mM imidazole. IN-His₆ was eluted with buffer A-200 mM imidazole. IN containing fractions identified by Na dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis were pooled and dialyzed overnight against buffer D [25 mM Tris-HCl, pH 7.4, 1 M NaCl, 7.5 mM CHAPS, 10% glycerol (w/v), 10 mM dithiothreitol (DTT)]. The His-Tag was removed using 40 U of thrombin (Sigma-Aldrich, St. Louis, MO) per mg of protein for 3 h at room temperature, which left the heterologous LVPR sequence at each C-terminus. After removal of thrombin by incubation with Benzamidine beads (Novagen, Madison, WI), IN was concentrated using Centricon-10 Concentrators (Millipore, Billerica, MA) and dialyzed against buffer D for 4 h. Protein concentration was determined by spectrophotometer, and aliquots flash frozen in liquid N₂ were stored at -80°C. Quantitative image analysis (Alpha Innotech FlourChem FC2, San Leandro, CA) of Coomassie-stained gels revealed that each IN preparation was minimally 90% pure.

Recombinant LEDGFp75 expressed in bacteria was purified as previously described 44. LEDGFp75 concentrations were determined using the Bio-Rad protein assay kit (Hercules, CA). Exonuclease III was from New England Biolabs (Beverley, MA).

Anti-IN monoclonal antibody 8G4 45 was purified from hybridoma cell supernatant using protein G sepharose (GE Healthcare, Piscataway, NJ) following the manufacturer's recommendations. 500 ml of cell supernatant loaded onto 1 ml of protein G beads were subsequently washed with phosphate-buffered saline. Antibody eluted with 20 mM glycine-HCl, pH 2.8 was immediately neutralized by addition of 1 M Tris-HCl, pH 8.5. Pooled fractions were concentrated by ultrafiltration, and resulting antibody concentration was determined by spectrophotometry.

Oligonucleotides that mimic the HIV-1 U5 end were used as viral DNA substrates. AE143 (5'-ACTGCTAGAGATTTTCCACACTGACTAAAA) and AE191 (5'-TTTTAGTCAGTGTGGAAAATCTCTAGCAG) were annealed prior to filling-in the 3' recess with [α-³²P]TTP (3000 Ci/mmol; PerkinElmer, Waltham, MA) using Sequenase version 2.0 T7 DNA polymerase (GE Healthcare) to label the phosphodiester within the pGT_OH dinucleotide that is cleaved during 3' processing 346. To prepare a 30 bp preprocessed duplex for DNA strand transfer, AE155 (5'-TTTTAGTCAGTGTGGAAAATCTCTAGCA) 5'-end labeled with [γ-³²P]ATP (3000 Ci/mmol; PerkinElmer) using T4 polynucleotide kinase (GE Healthcare) 46 was annealed with AE143. Unincorporated radionuclide was removed by passing labeled duplexes through Bio-Spin 6 columns (Bio-Rad) equilibrated with 10 mM Tris-HCl, pH 8.0-20 mM NaCl-0.1 mM EDTA.

Reaction mixtures (16 μl) contained 25 mM MOPS, pH 7.2, 10 mM DTT, 31 mM NaCl, 10 mM MgCl₂, 5 μM ZnSO₄, 5 nM DNA substrate, and 0.49 μM IN. Reactions stopped by addition of an equal volume of sequencing gel sample buffer (95% formamide, 10 mM EDTA, 0.003% xylene cyanol, 0.003% bromophenol blue) were boiled for 2 min prior to fractionation through 20% polyacrylamide- (3' processing) or 15% polyacrylamide-8.3 M urea (DNA strand transfer) sequencing gels. Reaction products in wet gels exposed to phosphor image plates were quantified using Image Quant version 1.2 (GE Healthcare).

LEDGFp75-dependent concerted integration activity was assayed essentially as previously described 31. A preprocessed 32 bp U5 end was prepared by annealing AE3653 (5'-CCTTTTAGTCAGTGTGGAAAATCTCTAGCA) with AE3652 (5'- ACTGCTAGAGATTTTCCACACTGACTAAAAGG). Reactions (36 μl) were initiated by mixing 0.5 μM HIV-1 DNA with 0.33 μg pGEM-3 target DNA in 25.3 mM NaCl, 5.5 mM MgSO₄, 11 mM DTT, 4.4 μM ZnCl₂, 22 mM HEPES-NaOH, pH 7.4. IN (2 μl) in dilution buffer (750 mM NaCl, 10 mM DTT, 25 mM Tris-HCl, pH 7.4) was then added. Following 2-3 min at room temperature, 2.0 μl of LEDGFp75 was added, and the reactions were allowed to proceed at 37°C for 1 h. The final concentrations of IN and LEDGFp75 were both 0.8 μM. Reactions stopped by the addition of EDTA and SDS to the final concentrations of 25 mM and 0.5%, respectively, were deproteinized using 30 μg proteinase K (Roche Molecular Biochemicals, Indianapolis, IN) for 60 min at 37°C. DNAs recovered following precipitation with ethanol were separated on 1.5% agarose-TAE (40 mM Tris base, 20 mM acetate, 1 mM EDTA) gels run in TAE at 150 V for 2 h. DNAs stained with ethidium bromide (0.5 μg/ml) were quantified using Alpha Innotech FlourChem FC2.

293T cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented to contain 10% fetal bovine serum (FBS) (Invitrogen Corporation, Carlsbad, CA). Cells were plated at 8.6 × 10⁶/10-cm dish 24 h prior to transfection. Virus stocks were prepared by co-transfecting cells with 10 μg pNLX.Luc(R-) and 1 μg of envelope expression vector pCG-VSV-G 47 using FuGene 6 as described by the manufacturer (Roche Molecular Biochemicals). Cell-free supernatants harvested at 48 h post-transfection were passed through 0.45 μm filters. Virus titer was determined using an exogenous reverse transcriptase (RT) assay as previously described 48. For western blot analysis, viruses pelletted by ultracentrifugation at 122,000 g for 2 h at 4°C were lysed for 15 min on ice in 40 μl of buffer containing 140 mM NaCl, 8 mM Na₂HPO₄, 2 mM NaH₂PO₄, 1% Nonidet P40, 0.5% Na deoxycholate, 0.05% SDS. Supernatant recovered after centrifugation at 19,800 g was stored at -80°C. Following electrophoresis and transfer to polyvinylidene fluoride, IN and p24 were detected using 1:100 and 1:5000 dilutions of 8G4 and 13-203-000 (Advanced Biotechnologies Inc, Columbia, MD) antibodies, respectively.

HeLa-T4 cells 49 were grown in DMEM-10% FBS containing 100 IU/ml penicillin and 100 μg/ml streptomycin. For infectivity measurements, cells plated at 75,000 cells/well of 24-well tissue culture plates 24 h prior to infection were incubated in duplicate with 10⁶ RT-cpm of virus for 17 h, after which cells washed with phosphate-buffered saline were replenished with fresh media. At 46 h post-infection, cells were collected, washed, and lysed using 75 μl passive lysis buffer as recommended by the manufacturer (Promega Corp., Madison, WI). Luciferase activities (20 μl), determined in duplicate for each infection, were normalized to total levels of cellular protein as previously described 42. For quantitative (Q)-PCR assays, 900,000 cells were plated per 10 cm dish the day before infection. Cells were infected with 2.3 × 10⁷ RT-cpm of TURBO DNase-treated 42 native or heat-inactivated (65°C for 30 min) virus. 8G4 hybridoma cells were grown in DMEM containing 10% ultra low IgG FBS (Invitrogen Corporation) with penicillin and streptomycin.

Total cellular DNA was isolated at 7 or 24 h post-infection using the QIAamp DNA mini kit (QIAGEN). Late reverse transcription (LRT) products were detected using primers and Taqman probe as previously described 5051. Two-long terminal repeat (2-LTR) containing circles were detected at 24 h post-infection using primers MH535/536 50 and SYBR green (QIAGEN). Integration was measured at 24 h using a modified nested HIV-1 R-Alu format based on reference 52. DNA (100 ng) was amplified using the phage lambda T-R chimera primer AE3014 53 and Alu-specific AE1066 (5'-TCCCAGCTACTCGGGAGGCTGAGG) with rTth DNA polymerase XL as recommended by the manufacturer (Applied Biosystems Inc, Foster City, CA). Samples (1 μl) were then analyzed by Q-PCR using SYBR green with primers AE989 and AE990 51. DNA generated from WT-infected cells was end-point diluted in DNA prepared from uninfected cells to generate the integration standard curve. LRT, 2-LTR, and Alu-integration Q-PCR values obtained from samples prepared using heat-inactivated virus were subtracted from those generated using native virus.

Little is known about the role of HIV-1 IN C-terminal tail (residues 271-288, Figure 1) in integration. This region of the protein, which overlaps the 5' end of the vif reading frame, is fairly well conserved among different HIV-1 isolates. Some clade C sequences harbor Ala in place of Asp-278 and numerous clades as well as SIVcpz carry Gly at position 283 (Figure 1); the remaining residues by contrast show little or no sequence variation 54. To ascertain the role of the tail in IN function, six nested deletions mutants lacking 3, 6, 9, 12, 15, or 18 amino acids from the C-terminus were constructed in the pKBIN6Hthr bacterial expression construct 39 and luciferase-based pNLX.Luc(R-) viral vector 42 (Figure 1). The CCD F185K mutation, which dramatically increases the solubility of the HIV-1 protein 38, was tested in some constructs to assess its potential affects on IN activities in vitro. The 1-266 deletion mutant, which lacked the C-terminal 22 residues and hence the fifth β strand of the CTD SH3 fold in addition to the tail (Figure 1) 3536, was used as a loss-of-function control 55. Finally, the 23 residue HIV-2 tail (underlined in Figure 1) was swapped for the corresponding HIV-1 sequence to test the functionality of this marginally related sequence substitution. Because the viral changes necessarily altered the overlapping vif sequence, these constructs incorporated stop codons downstream of the IN region within the vif frame to negate synthesis of altered Vif proteins. Viruses were constructed in 293T cells, which lack APOBEC3G and thus do not require functional Vif to yield infectious particles 56.

Recombinant proteins were engineered to contain C-terminal hexahistidine tags to facilitate purification. Though this might appear counterintuitive given the C-terminal focus of the study, it was necessary to obtain relatively pure preparations. The tail region is hypersensitive to proteolysis during expression in E. coli 57, and preliminary experiments with N-terminally tagged proteins yielded heterogeneous populations eluted from Ni-NTA beads whose purities were not substantially improved upon by subsequent ion exchange or size exclusion chromatography (data not shown). The C-terminal tag obviated this problem, as proteolyzed variants failed to bind Ni-NTA beads. Indeed, quantitative image analysis of purified WT and mutant proteins revealed near homogeneous preparations (Figure 2A).

IN activities were measured using three different assay designs, each of which incorporated an ~30 bp DNA mimic of the viral U5 end (Figure 2B-D). Overall levels of IN 3' processing and DNA strand transfer activities were determined in two separate assays using differentially labeled 30 bp substrates (Figure 2B and 2C). Under these conditions, the majority of DNA strand transfer reaction products result from the insertion of a single oligonucleotide end into one strand of a second target DNA molecule 8. By contrast, integration in cells proceeds via the concerted insertion of viral U3 and U5 DNA ends into opposing strands of chromosomal DNA. Reactions that contain relatively low concentrations of IN protein 58, relatively long viral DNA substrates 59, or relatively high concentrations of oligonucleotide substrate in the presence of LEDGFp75 31 support efficient concerted HIV-1 integration. Here, LEDGFp75 was used in a third assay format (Figure 2D) to monitor the concerted integration activities of IN mutant proteins. His₆-tags were removed from purified IN proteins by thrombin cleavage prior to enzyme assays, yielding the remnant LVPR C-terminal sequence. Experiments conducted with a subset of proteins prior to cleavage (WT, 1-279, 1-273, 1-270,1-266, and HIV-1/2) revealed similar levels of 3' processing activities relative to WT, indicating that the remnant sequence did not significantly influence mutant enzyme activities (data not shown).

To follow the course of the 3' processing reaction, oligonucleotide substrate DNA was labeled at the inter-nucleotide linkage of the 3'-terminal GT (Figure 2B); IN mediated hydrolysis liberates pGT_OH, which is readily distinguished from the 30 bp substrate following electrophoresis on high percentage DNA sequencing gels 34 (Figure 3A, lanes 2 and 3; results quantified in panel B). Exonuclease III-mediated hydrolysis by contrast yielded free pT_OH (Figure 3A, lanes 1 and 17). All IN preparations were basically void of contaminating exonuclease activity (Figure 3A), reflecting the relatively high degrees of protein purity (Figure 2A). IN_D64N and IN_1-266, which contained the substitution of Asn for active site residue Asp-64 14 and lacked part of the CTD SH3 fold, respectively, were predictably inactive (Figure 3A, lanes 15 and 16). The activities of the three mutants that retained most of the tail, IN_1-285, IN_1-282, and IN_1-279, were overall similar at 65-70% of WT (Figure 3A, lanes 5-7). Mutants with further progressive tail deletions yielded a stepwise reduction in 3' processing activity, as IN_1-276, IN_1-273, and IN_1-270 supported about 51%, 26%, and 13%, respectively, of WT function. Thus, IN_1-279 and IN_1-270 support Mg²⁺-dependent 3' processing activities that do not significantly differ from those reported using Mn²⁺ 25. The IN_HIV1/2 chimera protein like IN_1-270 retained marginal (about 12% of WT) activity (Figure 3A, lane 20; Figure 3B). The F185K solubility mutation marginally impacted activity, generally yielding 20-25% reductions when compared to the same protein lacking the CCD change (Figure 3B).

The preprocessed DNA strand transfer substrate was labeled at the 5' end of the strand that becomes joined to target DNA; IN activity yields a population of products that migrate more slowly than the starting substrate on DNA sequencing gels 8 (Figure 2C and 4A). Relative levels of IN mutant DNA strand transfer activities in large part mirrored 3' processing activities with some subtle differences noted (compare Figure 4B to Figure 3B). IN_1-285, IN_1-279, and IN_1-276 supported DNA strand transfer at basically the same level as the WT, whereas the activity of IN_1-270 was undetectable (Figure 4A, lanes 4-6 and 13; Figure 4B). Mn²⁺can support more robust IN activity than Mg²⁺ 960, which may have contributed to the previously reported residual level of IN_1-270 DNA strand transfer activity 25. IN_HIV1/2 DNA strand transfer activity, by contrast to IN_1-270, was increased from its relative level of 3' processing activity (Figure 4B and 3B).

Supercoiled pGEM-3 plasmid DNA was incorporated into the reaction mixture to help identify concerted integration reaction products (Figure 2D and 5A). Integration of only one donor DNA end into one plasmid DNA strand yields a tagged circle whose mobility through agarose matches that of starting relaxed circular plasmid (Figure 5A). Pairwise integration of two oligonucleotides by contrast yields a linearized product whose size is slightly larger than linear plasmid (Figure 2D). IN DNA strand transfer activity was barely detectable in the absence of LEDGFp75, yielding slight increases in the nicked or open circular plasmid population (Figure 5A, compare lanes 3 and 27 to lanes 2 and 26, respectively) 31. LEDGFp75 greatly stimulated IN activity such that the supercoiled target DNA was largely consumed, yielding a mixture of half-site and concerted integration products (Figure 5A, lanes 4 and 28). IN mutant product formation was quantified to reflect overall levels (half-site plus concerted, Figure 5B) of DNA strand transfer activities or just concerted integration (Figure 5C). The overall activities of the various deletion mutant proteins in large part mirrored their oligonucleotide-based DNA strand transfer activities (compare Figure 5B to 4B). Though 0.49 μM IN_HIV1/2 supported about 40% of IN_WT activity in the oligonucleotide-based assay (Figure 4B), 0.8 μM protein failed to support appreciable product formation in the concerted assay format (Figure 5A, lane 31). Doubling the amount of input IN_HIV1/2 to 1.6 μM yielded significant half-site product formation (about 66% of IN_WT, Figure 5A, lane 30 and Figure 5B) in the absence of detectable concerted integration activity (Figure 5C). Taken together, our data indicate that the C-terminal tail does not play a specific role in concerted DNA integration, though the introduction of a foreign sequence for the HIV-1 tail can uncouple pairwise from single end integration activity. Though others noted that the F185K substitution ablated Mg²⁺-dependent integration of preprocessed oligonucleotide donor DNA into heterologous target DNA 61, our reaction conditions failed to reveal an affect of the solubilizing mutation on full-length IN activity in the presence of LEDGFp75 (Figure 5A, lane 6; panels B and C). We furthermore conclude that the C-terminal 9 amino acids of HIV-1 IN can be removed without dramatically effecting Mg²⁺-based single end or concerted DNA integration activities (Figures 3, 4, 5)., We highlight these derivatives as potential candidates for structural biology studies despite the approximate 20-25% reductions in IN_1-279 and IN_1-276 activities brought on by the F185K change. We would by contrast advise against extensive analysis of tailless IN_1-270, due to its lack of detectable DNA strand transfer activity under these assay conditions (Figure 4 and 5).

To assess HIV-1 infectivity, HeLa-T4 cells were infected with normalized levels of single-round viruses that carry the luciferase reporter gene in place of nef. Two days post-infection, cells were harvested and resulting luciferase activities were normalized to the levels of total protein in the different cell extracts 4247. Deletion of up to 9 amino acids from the IN C-terminus failed to affect HIV-1 infectivity (Figure 6). IN mutants HIV-1_1-276 and HIV-1_1-273 supported about 50% and 20% of the level of WT infection, respectively, whereas HIV-1_1-270, HIV-1_1-266, and the HIV-1/2 tail chimera were non-infectious (Figure 6).

IN mutations can affect multiple steps in the HIV-1 replication cycle, including particle release from virus-producing cells and/or reverse transcription during the subsequent round of infection (reviewed in ref. 62). Viruses specifically blocked at integration are distinguished as class I, whereas class II mutants display additional stage defects. To assess potential affects on virus particle release, RT content in HeLa cell supernatants at 2 days post-transfection was normalized to levels of cell-associated luciferase activity. Normalized levels of mutant virus release did not significantly differ from the WT under this assay condition (data not shown). Defective mutant viruses (HIV-1_1-266, HIV-1_1-270, HIV-1_1-273, HIV-1_1-276, and HIV-1/2; Figure 6) produced from transfected 293T cells were analyzed by western blotting to assess levels of virion-incorporated IN protein. Monoclonal antibody 8G4, which recognizes discontinuous epitopes in the NTD and CCD 45, was utilized to avoid potential complications from the CTD mutations. Accordingly, 8G4 effectively recognized the different forms of recombinant IN protein (Figure 7, top panel). Based on relative levels of p24 content (bottom panel), we conclude that HIV-1_1-276, HIV-1_1-273, HIV-1_1-270, and HIV-1_1-266 harbor significantly less IN protein than WT HIV-1 (viral lysate panels, compare lanes 2-5 to lane 1), with HIV-1_1-266 suffering the most dramatic defect (lane 2). We therefore conclude that an intact SH3 fold plays an important role in Gag-Pol incorporation and/or IN retention in virions.

Q-PCR assays were utilized to assess defective mutant virus reverse transcription (LRT at 7 h post-infection) and 2-LTR circle formation and integration (nested Alu-R PCR) at 24 h. Virus stocks were treated with DNase prior to infection to digest plasmid DNA that may persist after transfection and hence template in the LRT reaction format. To control for potential plasmid carry-over, a parallel set of infections was conducted using heat-inactivated viruses. Resulting LRT values (typically 1-5%) were subtracted from native viral infections. HIV-1_1-276 and HIV-1_1-273 supported the WT levels of reverse transcription and circle formation (Figure 8A and 8B), whereas HIV-1_1-270, HIV-1_1-266, and the HIV-1/2 chimera supported about 25%, 5%, and 33% of WT LRT product formation (Figure 8A). Under these experimental conditions IN residues 271-273 contribute to reverse transcription. Due to the pleiotropic nature of HIV-1 IN mutations these results were not entirely unexpected. Residues 271-273 might influence the interaction between IN and RT 63, which occurs via the CTD 6465. An RT binding interface was recently mapped to β strands 2-4 of the SH3 fold 66 and though residues 271-273 abut β-5 (Figure 1), it is not unreasonable to suspect the disordered tail could affect RT binding. Alternatively, a number of NTD and CCD mutations in addition to CTD changes can impair DNA synthesis (see 62 for review), indicating that the C-terminal tail changes might perturb reverse transcription via global affects on IN and/or the preintegration complex.

HIV-1_1-276 and HIV-1_1-273 supported about 40% and 20% of WT integration, respectively (Figure 8C), indicating that their partial infectivities (Figure 6) were due to specific integration defects attributable to the intrinsic activities of the deletion mutant enzymes (Figure 3, 4, 5). Consistent with their non-infectious phenotypes and inabilities for recombinant IN proteins to catalyze concerted integration activity, neither HIV-1_1-270 nor the HIV-1/2 chimera supported a detectable level of integration during infection (Figure 8C). As both of these viruses supported the formation of detectable 2-LTR circles (Figure 8B), we group them as class II defective IN mutants that display marginal (3 to 4-fold) reverse transcription in additional to prominent integration defects. HIV-1_1-266 was a more severe class II mutant virus, harboring a significant reverse transcription as well as integration defect.